ID: 968671899

View in Genome Browser
Species Human (GRCh38)
Location 4:1856406-1856428
Sequence GGACGCCGGGGCTCGCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671894_968671899 -10 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115
968671890_968671899 14 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115
968671888_968671899 29 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115
968671892_968671899 -3 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671899 Original CRISPR GGACGCCGGGGCTCGCAGCG TGG Intergenic