ID: 968671900

View in Genome Browser
Species Human (GRCh38)
Location 4:1856409-1856431
Sequence CGCCGGGGCTCGCAGCGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671890_968671900 17 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112
968671892_968671900 0 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112
968671894_968671900 -7 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112
968671896_968671900 -8 Left 968671896 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671900 Original CRISPR CGCCGGGGCTCGCAGCGTGG CGG Intergenic