ID: 968671901

View in Genome Browser
Species Human (GRCh38)
Location 4:1856411-1856433
Sequence GGCCGCCACGCTGCGAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671901_968671908 12 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671901_968671909 13 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671909 4:1856447-1856469 GAGTCGGCCGCGCTTGCGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 40
968671901_968671904 -9 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301
968671901_968671907 11 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671907 4:1856445-1856467 GGGAGTCGGCCGCGCTTGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 57
968671901_968671903 -10 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671903 4:1856424-1856446 CGTGGCGGCCGCAGGAGCTGAGG 0: 1
1: 0
2: 3
3: 35
4: 337
968671901_968671905 -3 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671905 4:1856431-1856453 GCCGCAGGAGCTGAGGGAGTCGG 0: 1
1: 0
2: 4
3: 40
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671901 Original CRISPR GGCCGCCACGCTGCGAGCCC CGG (reversed) Intergenic