ID: 968671902

View in Genome Browser
Species Human (GRCh38)
Location 4:1856416-1856438
Sequence GCTCGCAGCGTGGCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671890_968671902 24 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671894_968671902 0 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671892_968671902 7 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671898_968671902 -9 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671896_968671902 -1 Left 968671896 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671902 Original CRISPR GCTCGCAGCGTGGCGGCCGC AGG Intergenic
900091971 1:924570-924592 GCGGGCAGCGAGGCGGCCGGGGG - Intergenic
902600903 1:17539730-17539752 CCTCGGAGCGCGGCGGGCGCGGG + Intergenic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903848289 1:26291215-26291237 GCTCACAGCCTGGCCCCCGCTGG - Intronic
903925191 1:26826835-26826857 GCGGGCAGCGGGGCGGCCCCGGG - Exonic
904744499 1:32702728-32702750 GCTGGCAGTGCGGCGGGCGCGGG - Exonic
905617211 1:39409273-39409295 GCCCACGGCGTGGCGGCTGCGGG + Intronic
905789771 1:40783910-40783932 GCTCGGAGCCTGGGGGCCGCCGG - Intergenic
905857806 1:41326122-41326144 CCTCACAGCATGGCGGCCTCAGG + Intergenic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
912855954 1:113168971-113168993 GCTGGCAGCGCAGAGGCCGCAGG + Intergenic
1063994988 10:11611214-11611236 GCCCGGAGCGTGGGGTCCGCGGG - Intronic
1064583530 10:16817259-16817281 TCTCGCTGCGTGGCCGCAGCGGG - Exonic
1069052682 10:63811627-63811649 GCTTTCAGCGGGGCGGCTGCCGG + Intergenic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1070987179 10:80699245-80699267 GCTCACAGCATGGTGGCCCCGGG - Intergenic
1076710677 10:132332122-132332144 GCGCTCAGCGTGGCGCCTGCGGG + Intergenic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1077017414 11:403176-403198 GCTCGCAGCGCTGCAGCAGCCGG - Exonic
1079361957 11:19777129-19777151 CCTCGCAGCGCGGAGGCCGCTGG - Intronic
1083669438 11:64291913-64291935 CCTCGGAGCGTGGCGGGCGGCGG - Intronic
1084225422 11:67712036-67712058 GTGCGAAGCGAGGCGGCCGCGGG - Intergenic
1084691778 11:70731816-70731838 CCTCGCAGCGTGGAGGCCACAGG - Intronic
1089397568 11:118145960-118145982 GCTTGGAGCTTGGCAGCCGCGGG + Intronic
1096178682 12:49539143-49539165 GCTGAGAGCGCGGCGGCCGCGGG + Exonic
1097191811 12:57222902-57222924 GATCGCAGCGTGGCGGGGACGGG + Intronic
1098029050 12:66235414-66235436 TCTCGCCGCGCGGCGGCGGCCGG + Intronic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1104928112 12:132324245-132324267 GCCGGCAGAGTGGGGGCCGCAGG + Intronic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1117252925 14:53953660-53953682 CCTGGGAGCGCGGCGGCCGCGGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121199582 14:92106316-92106338 GCTCCCAGGGCGGGGGCCGCGGG + Intronic
1121661613 14:95639434-95639456 CCTTGCAGCATGGCGGCCTCAGG + Intergenic
1129592789 15:76932020-76932042 CCTCGCACCGCGGCTGCCGCGGG + Intronic
1130549504 15:84881019-84881041 GCACGCAGCGCGGTGGCCCCTGG + Intergenic
1130674933 15:85943224-85943246 GCTCACAGCATGGCGGCCTGGGG - Intergenic
1132499112 16:276844-276866 GCCTGAAGCCTGGCGGCCGCCGG - Intronic
1132548500 16:544471-544493 ACCCGGAGCGTGGAGGCCGCGGG - Intronic
1137476088 16:48811134-48811156 TCTCCCAGCGCGGCGTCCGCAGG - Intergenic
1138635057 16:58331600-58331622 GCTCTCAGCCTGGCTGCCCCTGG + Intronic
1141231341 16:82170352-82170374 GCTCGCGGGGTGGCGGGCGCGGG + Intergenic
1141806503 16:86345411-86345433 GCTCCCAGCGTGGCTGCAGGAGG - Intergenic
1141807165 16:86349411-86349433 GCTCCCAGCGTGGCTGCAGGAGG - Intergenic
1141807590 16:86352100-86352122 GCTCCCAGCGTGGCTGCAGGAGG + Intergenic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1141994233 16:87626634-87626656 GCTCTGAGTGTGGCGGCCTCAGG - Intronic
1142120421 16:88383917-88383939 GCGCCCCGCGTGGCGGCGGCCGG + Intergenic
1142378957 16:89721222-89721244 GCGCGCCGCGTGGCCTCCGCCGG + Intronic
1142695065 17:1628945-1628967 GCTCGCGGCGGGGCGGGCGGGGG - Intergenic
1144828791 17:18120798-18120820 GCCCGGAGCTTGGGGGCCGCGGG - Exonic
1147672414 17:42184271-42184293 GCCCGCGGCGTGGTTGCCGCTGG + Exonic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1149597839 17:57874626-57874648 GCCTGCAGCGTGGCAACCGCAGG + Intronic
1150485040 17:65537549-65537571 GCGCCCGGCGAGGCGGCCGCGGG + Exonic
1152938230 17:83152807-83152829 GCTCGGAGCAGGGCGGCCGTGGG + Intergenic
1152965635 18:111845-111867 GCTGGCAGCCGGGAGGCCGCAGG + Intergenic
1153083152 18:1251921-1251943 GCTCACAGCGTGGTGTCTGCTGG + Intergenic
1155938690 18:31781399-31781421 GCTGGCAGGCTGGCAGCCGCTGG - Intergenic
1160724977 19:613867-613889 GCTCGCCGTGCGGCGGCCCCGGG - Exonic
1160763599 19:797635-797657 CCTCTCCGCGTGGCGGGCGCGGG + Intronic
1161115597 19:2494976-2494998 CCTCCCAGCGTGGCCGACGCAGG - Intergenic
1163159726 19:15457473-15457495 GCCCGCAGCGCTGCGCCCGCCGG + Exonic
1164990079 19:32676578-32676600 GCACGCGCCGCGGCGGCCGCTGG + Exonic
1166043637 19:40217380-40217402 GCTCTGAGAGTGCCGGCCGCGGG - Intronic
1166106793 19:40601595-40601617 GCTCCCGGCGGGGCGGCCCCGGG + Intronic
935757657 2:106289066-106289088 GCGCGCAGTGTGGCGGCAGCAGG - Intergenic
938186110 2:129233383-129233405 GCTCCCAGTGTGGCAGCAGCTGG - Intergenic
940830031 2:158456914-158456936 GCTGGCAGCGGGGCGGGCGGCGG + Intergenic
941020966 2:160407655-160407677 TCTCGCCGCGCGGCGGCGGCCGG + Intronic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
947729709 2:232421064-232421086 CCTGGCAGCGCGGCGGCAGCGGG + Intergenic
948140835 2:235670688-235670710 GCGGGCTGCGTGGCGGTCGCGGG - Intronic
1169496779 20:6123060-6123082 GCGCGCAGCGTGGCAGGCGAGGG + Exonic
1171431260 20:25084390-25084412 TTTCGCAGCGTGGCGGTGGCAGG + Intergenic
1175394883 20:58651144-58651166 GCTCGCAACGTTCCGGGCGCGGG - Intergenic
1176061602 20:63175140-63175162 GTGCGCACCGAGGCGGCCGCCGG + Intergenic
1176156983 20:63626915-63626937 CCTCGCCGCGGGGGGGCCGCGGG + Intronic
1176157155 20:63627546-63627568 GCTCCCAGCGTGGAGGGCGAGGG + Intergenic
1180987684 22:19915009-19915031 TCTGGCAGCGTGGAGGCCACTGG + Intronic
1181035511 22:20168126-20168148 GGTAGCGGCGTGGGGGCCGCAGG - Intergenic
1182077422 22:27504546-27504568 GCTCACAGCCGGGCTGCCGCTGG + Intergenic
1184755233 22:46512090-46512112 CCTGGCAGCGTGGGGGCCACTGG - Intronic
950207493 3:11092066-11092088 GCTCCCAGGGTGGCGGGCTCCGG - Intergenic
953033425 3:39192224-39192246 GCTCTCAGAGTGGCTGCCACAGG - Intronic
953614376 3:44477421-44477443 GCCCTCAGCGTGGCGGGGGCGGG + Intronic
966936327 3:184711987-184712009 GCTGGCGGCGTTGCGGCCGCAGG - Exonic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
969452322 4:7281689-7281711 GATGGCAGCCTGGGGGCCGCAGG + Intronic
971245843 4:24926905-24926927 CCTCGCAGCATGGCAGCCTCAGG + Intronic
972418725 4:38867660-38867682 CCTCGCAGCGTGGGGGTGGCCGG + Intronic
980102284 4:128553520-128553542 GCTCGCTGCGTGGCTGTCGGAGG + Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984667862 4:182448342-182448364 GCCCCCAGCCTGGCGCCCGCGGG - Intronic
985451646 4:190066435-190066457 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985453619 4:190073023-190073045 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985454609 4:190076316-190076338 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985455597 4:190079609-190079631 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985456581 4:190082903-190082925 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985457569 4:190086203-190086225 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985458556 4:190089496-190089518 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
985459545 4:190092796-190092818 GCTGGCAGCTGGGCGGCTGCAGG - Intergenic
990825417 5:59893329-59893351 GCTCGAGGCGTAGCGGCCGCGGG + Exonic
992105864 5:73448456-73448478 GCCCCCAGCGTGGCGCCCCCCGG - Intergenic
992487519 5:77210642-77210664 GCGGGGAGGGTGGCGGCCGCTGG + Intronic
999248386 5:150167285-150167307 CGGCGCAGCGTGGCGGCCGGAGG + Exonic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1000345817 5:160312551-160312573 GCTCGCAGGCTCCCGGCCGCCGG + Exonic
1002029332 5:176416430-176416452 GGTGACAGCGTCGCGGCCGCCGG - Exonic
1002098984 5:176848099-176848121 GGCCGCAGCGTGGGGGCTGCTGG - Intronic
1004044654 6:12012323-12012345 GCCTTCAGCGTGGCGGCTGCTGG + Exonic
1004516854 6:16328000-16328022 GCAGGCAGCGTGGTGGCCACGGG + Exonic
1006834024 6:36986070-36986092 GCTCGCGGCGGAGCGGCGGCGGG - Exonic
1007571054 6:42891073-42891095 GCCCGCAGCGGCGCGTCCGCAGG - Intergenic
1012475809 6:99613863-99613885 CCTGGCAGCGCGGCGGCTGCGGG - Exonic
1013232414 6:108169797-108169819 GCGCGCGGCGCGGCGGCCACCGG - Intronic
1014230213 6:118894612-118894634 GTTCGGCGCCTGGCGGCCGCGGG + Intronic
1014571715 6:123016814-123016836 GCTAGCAGATTGGTGGCCGCTGG - Intronic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1018807278 6:167271059-167271081 GCTGGCAGCGTCGCGGCACCTGG + Intergenic
1019577974 7:1746649-1746671 GCCCGCAGCACGGCGGCCGCGGG - Exonic
1020746933 7:12090657-12090679 CCTCGCAGCATGGCTGCCACTGG - Intergenic
1021998306 7:26201538-26201560 GTTCGCGGCGTGGCGCCCGGTGG - Exonic
1022112407 7:27239677-27239699 GCTCCCAGCTTGGCTTCCGCCGG - Intergenic
1026256711 7:68718545-68718567 GCCTGCAGAGTGGCGGCCCCAGG - Intergenic
1026665314 7:72336337-72336359 GCGCGCAGCCTGGTGGCCACTGG + Intronic
1034830614 7:154304893-154304915 GCGCCCTGCGTGGGGGCCGCAGG + Intronic
1035751909 8:2002282-2002304 GCGGGCGGCGTGGCGCCCGCGGG + Exonic
1035882697 8:3259363-3259385 GCTCTCAGCATGGAGGCTGCAGG + Intronic
1036454226 8:8893485-8893507 GCCCGCAGCATGCCCGCCGCCGG - Exonic
1043250044 8:78060848-78060870 GCTCTCAGCTTGGAGGCTGCTGG - Intergenic
1044591404 8:93917162-93917184 GCTCGCGGATCGGCGGCCGCGGG + Exonic
1046545789 8:115648418-115648440 GCACGCGTGGTGGCGGCCGCAGG + Intronic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049683253 8:143929169-143929191 GAGCGCAGCGTGGGGGCCGCAGG + Exonic
1049765650 8:144354149-144354171 ACTCTCCGCGTGGCGCCCGCAGG - Exonic
1058882496 9:109297661-109297683 CCTCGCTGCGTGGCAGCCCCTGG + Intronic
1061357363 9:130116568-130116590 GCTCACAGCATTGCGGCTGCAGG + Intronic
1062577528 9:137215531-137215553 GCTCCCAGGGTGGGGGCCGTGGG + Intronic
1062623237 9:137431823-137431845 GCTCCCAGGGTGGCAGCCGTGGG + Intronic
1186669855 X:11757919-11757941 GGGCGCAGCCTGGAGGCCGCGGG + Intergenic
1200111844 X:153744494-153744516 GCTGGCGGGGTGACGGCCGCAGG - Exonic