ID: 968671904

View in Genome Browser
Species Human (GRCh38)
Location 4:1856425-1856447
Sequence GTGGCGGCCGCAGGAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671892_968671904 16 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301
968671894_968671904 9 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301
968671901_968671904 -9 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301
968671898_968671904 0 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301
968671896_968671904 8 Left 968671896 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671904 Original CRISPR GTGGCGGCCGCAGGAGCTGA GGG Intergenic