ID: 968671908

View in Genome Browser
Species Human (GRCh38)
Location 4:1856446-1856468
Sequence GGAGTCGGCCGCGCTTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671901_968671908 12 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671906_968671908 -9 Left 968671906 4:1856432-1856454 CCGCAGGAGCTGAGGGAGTCGGC 0: 1
1: 0
2: 2
3: 69
4: 474
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671896_968671908 29 Left 968671896 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671898_968671908 21 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671894_968671908 30 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671908 Original CRISPR GGAGTCGGCCGCGCTTGCGC GGG Intergenic