ID: 968671909

View in Genome Browser
Species Human (GRCh38)
Location 4:1856447-1856469
Sequence GAGTCGGCCGCGCTTGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671906_968671909 -8 Left 968671906 4:1856432-1856454 CCGCAGGAGCTGAGGGAGTCGGC 0: 1
1: 0
2: 2
3: 69
4: 474
Right 968671909 4:1856447-1856469 GAGTCGGCCGCGCTTGCGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 40
968671901_968671909 13 Left 968671901 4:1856411-1856433 CCGGGGCTCGCAGCGTGGCGGCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 968671909 4:1856447-1856469 GAGTCGGCCGCGCTTGCGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 40
968671896_968671909 30 Left 968671896 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 968671909 4:1856447-1856469 GAGTCGGCCGCGCTTGCGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 40
968671898_968671909 22 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671909 4:1856447-1856469 GAGTCGGCCGCGCTTGCGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671909 Original CRISPR GAGTCGGCCGCGCTTGCGCG GGG Intergenic