ID: 968673411

View in Genome Browser
Species Human (GRCh38)
Location 4:1864305-1864327
Sequence TCCTGCCTCCAAGGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673411_968673422 -3 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673422 4:1864325-1864347 GGAGCCACCTGGGGCCTGGGAGG No data
968673411_968673431 30 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673411_968673420 -7 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673420 4:1864321-1864343 GGCAGGAGCCACCTGGGGCCTGG No data
968673411_968673430 19 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673430 4:1864347-1864369 GCGGGGCAGCTTGAGGCTGCTGG No data
968673411_968673425 1 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673425 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
968673411_968673426 2 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673426 4:1864330-1864352 CACCTGGGGCCTGGGAGGCGGGG No data
968673411_968673423 0 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673423 4:1864328-1864350 GCCACCTGGGGCCTGGGAGGCGG No data
968673411_968673421 -6 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673421 4:1864322-1864344 GCAGGAGCCACCTGGGGCCTGGG No data
968673411_968673429 12 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673429 4:1864340-1864362 CTGGGAGGCGGGGCAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673411 Original CRISPR TCCTGCCTCCAAGGAGGGGA GGG (reversed) Intergenic