ID: 968673413

View in Genome Browser
Species Human (GRCh38)
Location 4:1864309-1864331
Sequence TGGCTCCTGCCTCCAAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673413_968673430 15 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673430 4:1864347-1864369 GCGGGGCAGCTTGAGGCTGCTGG No data
968673413_968673426 -2 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673426 4:1864330-1864352 CACCTGGGGCCTGGGAGGCGGGG No data
968673413_968673431 26 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673413_968673421 -10 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673421 4:1864322-1864344 GCAGGAGCCACCTGGGGCCTGGG No data
968673413_968673425 -3 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673425 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
968673413_968673429 8 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673429 4:1864340-1864362 CTGGGAGGCGGGGCAGCTTGAGG No data
968673413_968673423 -4 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673423 4:1864328-1864350 GCCACCTGGGGCCTGGGAGGCGG No data
968673413_968673422 -7 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673422 4:1864325-1864347 GGAGCCACCTGGGGCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673413 Original CRISPR TGGCTCCTGCCTCCAAGGAG GGG (reversed) Intergenic