ID: 968673415

View in Genome Browser
Species Human (GRCh38)
Location 4:1864311-1864333
Sequence GGTGGCTCCTGCCTCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673415_968673423 -6 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673423 4:1864328-1864350 GCCACCTGGGGCCTGGGAGGCGG No data
968673415_968673431 24 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673415_968673425 -5 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673425 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
968673415_968673422 -9 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673422 4:1864325-1864347 GGAGCCACCTGGGGCCTGGGAGG No data
968673415_968673426 -4 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673426 4:1864330-1864352 CACCTGGGGCCTGGGAGGCGGGG No data
968673415_968673429 6 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673429 4:1864340-1864362 CTGGGAGGCGGGGCAGCTTGAGG No data
968673415_968673430 13 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673430 4:1864347-1864369 GCGGGGCAGCTTGAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673415 Original CRISPR GGTGGCTCCTGCCTCCAAGG AGG (reversed) Intergenic