ID: 968673424

View in Genome Browser
Species Human (GRCh38)
Location 4:1864329-1864351
Sequence CCCGCCTCCCAGGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673424_968673434 28 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673434 4:1864380-1864402 GAAGCCCTCTTTATCTGGCCTGG No data
968673424_968673435 29 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673435 4:1864381-1864403 AAGCCCTCTTTATCTGGCCTGGG No data
968673424_968673430 -5 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673430 4:1864347-1864369 GCGGGGCAGCTTGAGGCTGCTGG No data
968673424_968673431 6 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673424_968673433 23 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673433 4:1864375-1864397 ACTTGGAAGCCCTCTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673424 Original CRISPR CCCGCCTCCCAGGCCCCAGG TGG (reversed) Intergenic