ID: 968673428

View in Genome Browser
Species Human (GRCh38)
Location 4:1864339-1864361
Sequence CTCAAGCTGCCCCGCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673428_968673438 23 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673438 4:1864385-1864407 CCTCTTTATCTGGCCTGGGACGG No data
968673428_968673434 18 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673434 4:1864380-1864402 GAAGCCCTCTTTATCTGGCCTGG No data
968673428_968673433 13 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673433 4:1864375-1864397 ACTTGGAAGCCCTCTTTATCTGG No data
968673428_968673439 30 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673439 4:1864392-1864414 ATCTGGCCTGGGACGGAGAAAGG No data
968673428_968673431 -4 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673428_968673435 19 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673435 4:1864381-1864403 AAGCCCTCTTTATCTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673428 Original CRISPR CTCAAGCTGCCCCGCCTCCC AGG (reversed) Intergenic