ID: 968673431

View in Genome Browser
Species Human (GRCh38)
Location 4:1864358-1864380
Sequence TGAGGCTGCTGGTTTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673415_968673431 24 Left 968673415 4:1864311-1864333 CCTCCTTGGAGGCAGGAGCCACC No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673424_968673431 6 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673414_968673431 25 Left 968673414 4:1864310-1864332 CCCTCCTTGGAGGCAGGAGCCAC No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673427_968673431 3 Left 968673427 4:1864332-1864354 CCTGGGGCCTGGGAGGCGGGGCA No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673428_968673431 -4 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673413_968673431 26 Left 968673413 4:1864309-1864331 CCCCTCCTTGGAGGCAGGAGCCA No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673411_968673431 30 Left 968673411 4:1864305-1864327 CCCTCCCCTCCTTGGAGGCAGGA No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673412_968673431 29 Left 968673412 4:1864306-1864328 CCTCCCCTCCTTGGAGGCAGGAG No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data
968673416_968673431 21 Left 968673416 4:1864314-1864336 CCTTGGAGGCAGGAGCCACCTGG No data
Right 968673431 4:1864358-1864380 TGAGGCTGCTGGTTTCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673431 Original CRISPR TGAGGCTGCTGGTTTCCACT TGG Intergenic