ID: 968673432

View in Genome Browser
Species Human (GRCh38)
Location 4:1864373-1864395
Sequence AGATAAAGAGGGCTTCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673432_968673439 -4 Left 968673432 4:1864373-1864395 CCACTTGGAAGCCCTCTTTATCT No data
Right 968673439 4:1864392-1864414 ATCTGGCCTGGGACGGAGAAAGG No data
968673432_968673440 0 Left 968673432 4:1864373-1864395 CCACTTGGAAGCCCTCTTTATCT No data
Right 968673440 4:1864396-1864418 GGCCTGGGACGGAGAAAGGCTGG No data
968673432_968673444 25 Left 968673432 4:1864373-1864395 CCACTTGGAAGCCCTCTTTATCT No data
Right 968673444 4:1864421-1864443 TCAGAGTGCACACATCTCCATGG No data
968673432_968673441 1 Left 968673432 4:1864373-1864395 CCACTTGGAAGCCCTCTTTATCT No data
Right 968673441 4:1864397-1864419 GCCTGGGACGGAGAAAGGCTGGG No data
968673432_968673443 2 Left 968673432 4:1864373-1864395 CCACTTGGAAGCCCTCTTTATCT No data
Right 968673443 4:1864398-1864420 CCTGGGACGGAGAAAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673432 Original CRISPR AGATAAAGAGGGCTTCCAAG TGG (reversed) Intergenic