ID: 968673435

View in Genome Browser
Species Human (GRCh38)
Location 4:1864381-1864403
Sequence AAGCCCTCTTTATCTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673428_968673435 19 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673435 4:1864381-1864403 AAGCCCTCTTTATCTGGCCTGGG No data
968673427_968673435 26 Left 968673427 4:1864332-1864354 CCTGGGGCCTGGGAGGCGGGGCA No data
Right 968673435 4:1864381-1864403 AAGCCCTCTTTATCTGGCCTGGG No data
968673424_968673435 29 Left 968673424 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG No data
Right 968673435 4:1864381-1864403 AAGCCCTCTTTATCTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673435 Original CRISPR AAGCCCTCTTTATCTGGCCT GGG Intergenic
No off target data available for this crispr