ID: 968673438

View in Genome Browser
Species Human (GRCh38)
Location 4:1864385-1864407
Sequence CCTCTTTATCTGGCCTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673428_968673438 23 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673438 4:1864385-1864407 CCTCTTTATCTGGCCTGGGACGG No data
968673427_968673438 30 Left 968673427 4:1864332-1864354 CCTGGGGCCTGGGAGGCGGGGCA No data
Right 968673438 4:1864385-1864407 CCTCTTTATCTGGCCTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673438 Original CRISPR CCTCTTTATCTGGCCTGGGA CGG Intergenic
No off target data available for this crispr