ID: 968673439

View in Genome Browser
Species Human (GRCh38)
Location 4:1864392-1864414
Sequence ATCTGGCCTGGGACGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968673428_968673439 30 Left 968673428 4:1864339-1864361 CCTGGGAGGCGGGGCAGCTTGAG No data
Right 968673439 4:1864392-1864414 ATCTGGCCTGGGACGGAGAAAGG No data
968673432_968673439 -4 Left 968673432 4:1864373-1864395 CCACTTGGAAGCCCTCTTTATCT No data
Right 968673439 4:1864392-1864414 ATCTGGCCTGGGACGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968673439 Original CRISPR ATCTGGCCTGGGACGGAGAA AGG Intergenic
No off target data available for this crispr