ID: 968674388

View in Genome Browser
Species Human (GRCh38)
Location 4:1870144-1870166
Sequence CAGCGGAGGCGGCGCGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968674376_968674388 11 Left 968674376 4:1870110-1870132 CCCATACAGGGGCCCAGCACCTG No data
Right 968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG No data
968674374_968674388 22 Left 968674374 4:1870099-1870121 CCACAACTCAACCCATACAGGGG No data
Right 968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG No data
968674377_968674388 10 Left 968674377 4:1870111-1870133 CCATACAGGGGCCCAGCACCTGT No data
Right 968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG No data
968674380_968674388 -1 Left 968674380 4:1870122-1870144 CCCAGCACCTGTGAAGGGACAGC No data
Right 968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG No data
968674383_968674388 -8 Left 968674383 4:1870129-1870151 CCTGTGAAGGGACAGCAGCGGAG No data
Right 968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG No data
968674381_968674388 -2 Left 968674381 4:1870123-1870145 CCAGCACCTGTGAAGGGACAGCA No data
Right 968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968674388 Original CRISPR CAGCGGAGGCGGCGCGGGAG AGG Intergenic
No off target data available for this crispr