ID: 968674587

View in Genome Browser
Species Human (GRCh38)
Location 4:1870924-1870946
Sequence CAAGCTCCTGTCCCGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968674587_968674593 -9 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674587_968674592 -10 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674587_968674599 22 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674587_968674594 -6 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674594 4:1870941-1870963 AGCTTGGGGACCCGCGCGGGCGG No data
968674587_968674595 -5 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674595 4:1870942-1870964 GCTTGGGGACCCGCGCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968674587 Original CRISPR CAAGCTCCTGTCCCGTGAGA GGG (reversed) Intergenic
No off target data available for this crispr