ID: 968674592

View in Genome Browser
Species Human (GRCh38)
Location 4:1870937-1870959
Sequence CAGGAGCTTGGGGACCCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 196}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968674583_968674592 -3 Left 968674583 4:1870917-1870939 CCCGCGCCCCTCTCACGGGACAG No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674584_968674592 -4 Left 968674584 4:1870918-1870940 CCGCGCCCCTCTCACGGGACAGG No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674578_968674592 4 Left 968674578 4:1870910-1870932 CCCAGGCCCCGCGCCCCTCTCAC No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674582_968674592 -2 Left 968674582 4:1870916-1870938 CCCCGCGCCCCTCTCACGGGACA No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674579_968674592 3 Left 968674579 4:1870911-1870933 CCAGGCCCCGCGCCCCTCTCACG No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674575_968674592 13 Left 968674575 4:1870901-1870923 CCCGCGGGCCCCAGGCCCCGCGC 0: 1
1: 1
2: 5
3: 65
4: 564
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674577_968674592 5 Left 968674577 4:1870909-1870931 CCCCAGGCCCCGCGCCCCTCTCA No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674574_968674592 16 Left 968674574 4:1870898-1870920 CCTCCCGCGGGCCCCAGGCCCCG No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674587_968674592 -10 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674572_968674592 26 Left 968674572 4:1870888-1870910 CCGCTAGCAGCCTCCCGCGGGCC 0: 1
1: 0
2: 1
3: 10
4: 175
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674586_968674592 -9 Left 968674586 4:1870923-1870945 CCCCTCTCACGGGACAGGAGCTT No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196
968674576_968674592 12 Left 968674576 4:1870902-1870924 CCGCGGGCCCCAGGCCCCGCGCC No data
Right 968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968674592 Original CRISPR CAGGAGCTTGGGGACCCGCG CGG Intergenic
900591788 1:3463437-3463459 GAGGAGCTTAGGGTCCCGCCGGG - Exonic
901081970 1:6588701-6588723 CAGGAGCCCCGGGACCCTCGAGG - Intronic
902470330 1:16644483-16644505 CTGGAGCTTGGGGCCAGGCGGGG - Intergenic
902803652 1:18847240-18847262 CAGGAGCTTGGGGAGAAGCCTGG + Intronic
903136747 1:21314330-21314352 CAGGAATTTGGGGGCCCGGGAGG - Intronic
903378290 1:22880029-22880051 AATGAGCCTGGGGACCAGCGTGG - Intronic
904815942 1:33198455-33198477 CAGGAGTTTGGAGACCAGCCTGG + Intergenic
905863351 1:41364380-41364402 GAGGTGCTTGGGGACCCTGGAGG - Intronic
907491386 1:54811010-54811032 CACGTGCTTGGGGAGCAGCGAGG - Intronic
907541713 1:55221422-55221444 CAGGAGATTTGGGACCAGCCTGG - Intergenic
914003952 1:143716764-143716786 CAGGAGTTTGGGGACCAGCCTGG + Intergenic
914095173 1:144539115-144539137 CAGGAGTTTGGGGACCACCATGG + Intergenic
914303349 1:146394781-146394803 CAGGAGTTTGGGGACCACCATGG - Intergenic
914516390 1:148378399-148378421 CAGGAGTTTGGGGACCAGCATGG + Intergenic
916227125 1:162499373-162499395 CAGGAGTTTGGAGACCAGCCTGG - Intronic
918366462 1:183813076-183813098 CTGGAGCATGGGGACCCAGGAGG + Intronic
920144421 1:203846066-203846088 CAGGAGTTTGGAGACCAGCCTGG + Intronic
920210920 1:204327657-204327679 CAGGAGCTTGTGGTCCCCTGGGG - Intronic
1062865738 10:851854-851876 CAGGAGTTTGGAGACCAGCCTGG + Intronic
1064167772 10:13001516-13001538 CGGGCGCTGGGGGACCCGCCAGG + Exonic
1067067839 10:43113576-43113598 CACGAGCCTGGGGAGCCCCGGGG + Exonic
1067299187 10:44993677-44993699 CAGGGGCTTGTGGACCCACAGGG - Exonic
1069518458 10:69098748-69098770 CAGGAGGTTTGGGACCAGCCTGG + Intronic
1069962349 10:72086637-72086659 CAGGAGCCTGGAGCCCCGCGAGG - Intronic
1073475387 10:103749189-103749211 CAGGAGCTCGGGGAGCAGCCTGG + Intronic
1073533599 10:104254946-104254968 CAGGAGCTTGGGGAAGGGTGAGG + Exonic
1074756520 10:116627840-116627862 CAGGAGGCTGGGGGGCCGCGTGG + Exonic
1077147186 11:1051563-1051585 CAGGGCCTTGGGGACCCCCTTGG - Intergenic
1077351018 11:2093213-2093235 CAGCAGCTTGGGGCCTCGCCAGG + Intergenic
1077433294 11:2526545-2526567 CAGGAGCTTGGGGAAGGGGGTGG + Intronic
1077482859 11:2824722-2824744 CAGGAGCTTGGGCATCCTAGAGG + Intronic
1077508369 11:2942662-2942684 CAGGAGTTTGGGGAGCAGCCCGG - Intergenic
1078390367 11:10931408-10931430 CAGGAGCAAGGGGCCCGGCGCGG + Intergenic
1078934266 11:15938307-15938329 CAGGAGCGGGGGGAGCCGCGGGG - Intergenic
1079370429 11:19847507-19847529 CCTGAGCTTGGGGACCAGCCAGG + Intronic
1081731136 11:45372517-45372539 CAGGAGCTCGGAGACCAGCCTGG - Intergenic
1081977223 11:47243251-47243273 CAGCAGCTTGGGGAGCTGGGAGG + Exonic
1082775387 11:57240793-57240815 CAGGAGCCTGGAGACCCCTGTGG + Intergenic
1084552144 11:69850977-69850999 TAGGAGCTTGGGGATCAGAGTGG + Intergenic
1085304603 11:75477944-75477966 CAGGTCCTTGGGGACCTGCAGGG - Intronic
1088047359 11:105470382-105470404 CAGGAGTTTGGAGACCAGCCTGG + Intergenic
1089011319 11:115134310-115134332 CAGGAGCTCGGAGACCAGCCTGG + Intergenic
1089698915 11:120232431-120232453 GAGGAGCATGGGCACCCGCTGGG + Intergenic
1092124424 12:6065547-6065569 CAGGAGCGTGGGTTCCTGCGTGG - Intronic
1092138157 12:6163971-6163993 GAGTAGCTAGGGGACCCTCGAGG + Intergenic
1096341977 12:50808536-50808558 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1096676584 12:53229647-53229669 CAGGAGTTTGGGGGCCCCTGAGG + Intronic
1097072103 12:56362581-56362603 CAGAAGCTTGGGGCCAGGCGCGG - Intronic
1099411819 12:82339320-82339342 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1102862638 12:116349941-116349963 CAGGAGTTTGGAGACCAGCCTGG + Intergenic
1103778601 12:123384319-123384341 GGCAAGCTTGGGGACCCGCGTGG + Intronic
1103896766 12:124278251-124278273 CAGGAGTTTGGGGAGCCAGGAGG - Intronic
1104640421 12:130463490-130463512 CAGGAGCTGGGGGAGCTGTGGGG - Intronic
1105534045 13:21247647-21247669 CTGGAGCTGGGGGACCTGGGTGG + Intergenic
1105537938 13:21287508-21287530 CAGGTGCTGCGGGACCTGCGGGG + Intergenic
1107478685 13:40766501-40766523 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1109741174 13:66557941-66557963 CAGGAGTTTGGAGACCAGTGTGG + Intronic
1110213736 13:73003462-73003484 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1112322814 13:98422487-98422509 AAGGAGCTTGGGGAGCCTGGGGG + Intronic
1113515650 13:110895371-110895393 CAGGAGCTTTGAGACCAGCTTGG + Intronic
1117630388 14:57684618-57684640 CAGGAGGTTGGGGAGCCTGGGGG + Intronic
1118782519 14:69018355-69018377 AAGGATCTTGGGGACCGTCGGGG - Intergenic
1123102534 14:105815027-105815049 CAGGAGGTTTGGGACCAGCCTGG - Intergenic
1126813628 15:52433628-52433650 CAGGAGTTTGGAGACCAGCTTGG - Intronic
1127457565 15:59168828-59168850 CAGGAGGTTTGGGACCCACCTGG - Intronic
1131263555 15:90902754-90902776 CAGAGGCTGGCGGACCCGCGCGG + Intronic
1131802389 15:96084486-96084508 CAGGAGCTTGGAGAACCAAGTGG + Intergenic
1132684920 16:1158296-1158318 CAAGAGCTGGGGGAGCCGTGGGG + Intronic
1132696755 16:1205399-1205421 CAGGTGCTTGGTGACCCCAGTGG + Intronic
1132790054 16:1680889-1680911 CAGGAGCATGGAGACCCCCGAGG + Intronic
1132889556 16:2196954-2196976 CAGAGGCTGCGGGACCCGCGGGG + Intergenic
1133230692 16:4365133-4365155 CAGGTCCTTGGGGACCTGTGGGG - Intronic
1135535111 16:23287851-23287873 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1135567338 16:23521606-23521628 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1136109741 16:28057270-28057292 CAGGAGCAGGGGGAGCTGCGGGG + Intronic
1138352329 16:56352599-56352621 GCTGAGCTTGGGGACCCGTGTGG - Intronic
1139851470 16:69953271-69953293 CAGGAGCTGGGGGCTCCCCGGGG - Intronic
1139880446 16:70176183-70176205 CAGGAGCTGGGGGCTCCCCGGGG - Intronic
1140372064 16:74419334-74419356 CAGGAGCTGGGGGCTCCCCGGGG + Intronic
1140477272 16:75245268-75245290 CAGGGGCTGGGGGACCCGGAGGG - Intronic
1141368506 16:83466044-83466066 CAGGAGCTTGTGGTCTCTCGAGG + Intronic
1141437474 16:84008592-84008614 CAGGAGCTTGAGAACCAGCCTGG - Intergenic
1142155630 16:88531784-88531806 CAGGAGCCCTGGGACCCGTGGGG - Intronic
1144595291 17:16564926-16564948 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1145925773 17:28645381-28645403 GCGGGGCTCGGGGACCCGCGGGG + Intronic
1147598267 17:41730590-41730612 CAGTAGCCTGGGGACCAGTGGGG + Intronic
1148837799 17:50475226-50475248 CAGGAGTTTGAGGACCAGCCTGG - Intergenic
1148849630 17:50548378-50548400 CAGGCGGTTGGGGACCCTCTGGG - Exonic
1148880130 17:50719411-50719433 CGGGCGCTTGGGGAGGCGCGCGG + Intergenic
1149616264 17:58002801-58002823 CAGGAGTTTTGGGACCAGCCTGG + Intronic
1149687757 17:58547177-58547199 CAGGAGCTTGGGGCCCACCTTGG + Intergenic
1150237488 17:63604803-63604825 CAGGAGTTTGGAGACCAGCCTGG + Intronic
1151556368 17:74848805-74848827 CAGGAGTTTGGAGACCAGCCTGG + Intronic
1151773351 17:76179481-76179503 CAGGAGCTTTGAGACCGGCCTGG + Intronic
1151784761 17:76270139-76270161 CAGTGGCTCGGGGACCCCCGAGG + Intronic
1152224684 17:79087243-79087265 CAGGAGCTGCAGGACCCGCGGGG + Intronic
1152649405 17:81484865-81484887 CAGGAGCTGGGGGAGCAGCCAGG + Intergenic
1152854820 17:82658687-82658709 CAGGATCTTGGGGACTCCGGGGG + Exonic
1154325305 18:13386844-13386866 CAGGAGTTTGGAGACCAGCCTGG + Intronic
1157386536 18:47263281-47263303 CTGGAGCTTGGGGACCTACGAGG - Intergenic
1157753093 18:50195232-50195254 GAGGAGCTCCGGGACCGGCGCGG + Intergenic
1158453445 18:57586711-57586733 CAGGGGGCTGGGGACGCGCGTGG - Intronic
1160436598 18:78856848-78856870 CCGGAGCCTGGGGACGCGCTGGG + Intergenic
1160500227 18:79397986-79398008 CGGCAGCATGGGGACACGCGTGG + Intronic
1160699694 19:499960-499982 CAGAAGCTGGGAGACCCGGGAGG + Intronic
1160970359 19:1765203-1765225 CTGGACCTTGGGGACCCCCCAGG + Intronic
1161013171 19:1969862-1969884 CCGGAGCTCGGGGACCAGCTCGG + Exonic
1161141954 19:2653465-2653487 CAGGAGCTGGGGGGCCCCCCTGG + Intronic
1161471227 19:4457578-4457600 CAGGGGCTTGAGGCCCTGCGGGG - Intronic
1165347065 19:35255126-35255148 CAGGAGCTGGGAGACCAGCCTGG + Intronic
934588607 2:95526985-95527007 GAGCAGCTTGGGGCCCAGCGTGG + Intergenic
935196623 2:100820179-100820201 CAGGAGCCGAGGGACCCGCGCGG + Exonic
935738424 2:106125458-106125480 GAGGAGCTTGGCGACCCGGGAGG + Intronic
936713946 2:115162601-115162623 ACGGAGCTTGGGGAGCGGCGAGG + Intronic
940009516 2:149038934-149038956 CAGGAGCTCGCGGGGCCGCGGGG + Intronic
940517343 2:154698258-154698280 CGGGAGATTGGGGAGCGGCGGGG + Intergenic
941431534 2:165419991-165420013 CAGGAGTTTGAGAACCAGCGTGG - Intergenic
946020700 2:216637976-216637998 CAGGAGTTTGGAGACCAGCCTGG + Intronic
946712845 2:222524040-222524062 CAGGAGCTTGGGGTTCAGAGAGG - Intronic
946920992 2:224582173-224582195 CAGGAGCTTTGAGACCAGCCGGG - Intronic
948753602 2:240146183-240146205 CAGAAGCATGTGGACCCGCCTGG + Intergenic
948845430 2:240680680-240680702 CAGCAGCTTGGGGGCCCCCCAGG + Intronic
948848431 2:240694199-240694221 CAGCAGCTTGGGGGCCCCCCAGG - Intronic
949021575 2:241743894-241743916 CAGGTGCATGGGGCCCCTCGGGG + Intronic
1169091532 20:2863997-2864019 CAGAAGCTGGGGGACACGCCTGG + Exonic
1170277261 20:14605288-14605310 CAGGAGCAAGGGGACCAGCATGG - Intronic
1171450157 20:25230015-25230037 CAGGAGCTTGGGGACTTACCTGG + Intergenic
1172380472 20:34486226-34486248 CAGGAGTTTGGAGACCAGCCTGG - Intronic
1172716143 20:36965174-36965196 CAGGAGTTTGGAGACCAGCCTGG + Intergenic
1172718389 20:36981005-36981027 CAGGAGTTTGGAGACCAGCCTGG - Intergenic
1174204130 20:48827307-48827329 CAGGGGCTTGGGGACCCCGGCGG - Intronic
1175397830 20:58679088-58679110 CAGGAGCTTTGGAAAACGCGTGG - Exonic
1175975578 20:62708880-62708902 CGGGGGCCTGGGGAACCGCGCGG + Exonic
1176041436 20:63067932-63067954 CAGGGGCGTCGAGACCCGCGGGG + Intergenic
1176289268 21:5035574-5035596 CAGGACCCTGGGGACCCTCAGGG - Intronic
1176291672 21:5048814-5048836 CAGGAGTTTGGAGACCAGCCTGG - Intergenic
1178710062 21:34909144-34909166 CAGGAGCATGGGGAGCCACACGG - Intronic
1179563072 21:42228984-42229006 CAGGAGGGTGGCGACCCGTGTGG - Intronic
1179570591 21:42276391-42276413 CAGGGGCTTGGCGACCAGCCTGG - Intronic
1179865583 21:44214827-44214849 CAGGAGTTTGGAGACCAGCCTGG + Intergenic
1179867967 21:44228030-44228052 CAGGACCCTGGGGACCCTCAGGG + Intronic
1181000695 22:19986722-19986744 CAGGTGCCTGGGGACACGGGTGG - Intronic
1181107827 22:20585184-20585206 CAGGAACTTGGGGTCCAGCCTGG - Exonic
1181300771 22:21879552-21879574 CAGGAGTTTGGAGACCAGCCTGG + Intergenic
1181563052 22:23716903-23716925 GAGTACCTGGGGGACCCGCGAGG - Intergenic
1183358165 22:37370369-37370391 CAGGAGCTTGGGGCTTCGTGGGG - Exonic
1183726406 22:39592353-39592375 CTGTGGCTTGGGGACCCCCGTGG + Intronic
951906403 3:27712269-27712291 GAGGAGCCTGCAGACCCGCGCGG + Intergenic
953646708 3:44761991-44762013 CAGGAGCTGAGTGACCGGCGGGG + Intronic
953805065 3:46061681-46061703 CTGGAGCCTGGGGTCCTGCGAGG + Intergenic
960955162 3:123026614-123026636 GAGGGGATCGGGGACCCGCGCGG - Intronic
962502648 3:136010714-136010736 CAGGAGTTTGGGGATGGGCGCGG - Intronic
964556550 3:157945875-157945897 CATGAGCTTGGGGACTGGCAGGG - Intergenic
966174318 3:177119179-177119201 CAGGAGTTTGGAGACCAGCCCGG - Intronic
968447994 4:662117-662139 CAGGACCTGGGGGAGCCGAGAGG - Exonic
968584849 4:1411535-1411557 CAGGAGCTTGGGGACAAGGGAGG - Intergenic
968674592 4:1870937-1870959 CAGGAGCTTGGGGACCCGCGCGG + Intergenic
970376241 4:15460119-15460141 CAGAAGCTTGGGGACCTGTAGGG - Intergenic
970432382 4:16000934-16000956 TAGGGGCCTGGGGACCCACGAGG + Intronic
973906660 4:55539021-55539043 CATGAGTTTGGAGACCTGCGTGG + Intronic
974543841 4:63275144-63275166 TAGGAGCTTGGGGAGCCTTGGGG - Intergenic
976123673 4:81810177-81810199 CAGGAGTTTGGAGACCAGCCTGG + Intronic
976509817 4:85895033-85895055 CAGGATTTTGGGGACTCACGAGG + Intronic
977306462 4:95329080-95329102 CAGGAGTTTGGAGACCAGCCTGG + Intronic
977979644 4:103307049-103307071 CATGAGCTTGGGGCCCTGCCTGG + Intergenic
978782534 4:112571591-112571613 CAGGAGTTTGGAGACCAGCCTGG - Intronic
981782211 4:148442740-148442762 CGGGAGCTTGGGGTGCCGGGCGG + Intronic
983229552 4:165115278-165115300 CAGGAGTTTTGAGACCAGCGTGG - Intronic
984890337 4:184486437-184486459 CAGGAGTTTGAGGACCAGCCTGG + Intergenic
985515731 5:343763-343785 CAGGAGGTGGGGGCCTCGCGGGG + Intronic
985973204 5:3393448-3393470 CCAGAGCTTGTGGACCCCCGAGG - Intergenic
986717064 5:10532509-10532531 CAGGGGCTTGGGGAAAGGCGTGG + Intergenic
992444258 5:76819857-76819879 CAGGAGCAGCGGGACCCGGGTGG - Intronic
992696061 5:79288775-79288797 CAGGAGTTGGGAGACCAGCGTGG - Intronic
998037713 5:138930952-138930974 GAGGAGCTTGGAGACCCACCTGG - Intronic
999259594 5:150229656-150229678 GAGGAGCTTGGGGACCACAGGGG + Intronic
1000508587 5:162153241-162153263 CAGGAGCTTGGAGACATGGGAGG + Exonic
1001080874 5:168666447-168666469 CAGGGGCTTAGGAACACGCGAGG + Exonic
1001809175 5:174614028-174614050 CAGGAGCTTTGGGAACAGAGAGG - Intergenic
1001976712 5:176006365-176006387 CAGGAGCTTGGGGATCAGGTTGG - Intronic
1002181234 5:177432133-177432155 CAGGACCTCGGCCACCCGCGGGG - Intronic
1002240713 5:177837416-177837438 CAGGAGCTTGGGGATCAGGTTGG + Intergenic
1004770621 6:18777072-18777094 CAGGAGTTTTGGGACCAGCCTGG - Intergenic
1006327440 6:33365055-33365077 CAGCAGCAAGGGGACCCCCGGGG + Intergenic
1006578757 6:35064553-35064575 CAGGGGCTTGGGGACCTGGTTGG - Intronic
1009969278 6:70609375-70609397 CAGGAGACTGGGGGGCCGCGTGG + Intergenic
1011194333 6:84766394-84766416 CCGGAGCTTGGAGACCCACTAGG - Intergenic
1011362231 6:86539840-86539862 CAAGAGCTTGAGGACCAGCCTGG + Intergenic
1019360058 7:600032-600054 CAGGAGCTGGGGGAGGCGCATGG + Intronic
1019686964 7:2387315-2387337 GAGGATCTTGGGGACCCCAGTGG - Intergenic
1026832450 7:73618537-73618559 CAGGAACTTGGAGACCAGGGAGG - Intronic
1027220576 7:76211328-76211350 CAGGTGCTTGGGGAACAGCATGG + Intronic
1032306133 7:130733833-130733855 CGGGAGCTGGGGGACCGACGCGG + Exonic
1034139138 7:148800228-148800250 CAGGTGCTTCGGGAGCCCCGTGG - Intronic
1034591275 7:152141497-152141519 CAGGAGTTTGAGGACCAGCCTGG + Intronic
1035349992 7:158238952-158238974 CAGGAGTCTGGGGAGCCGCGTGG - Intronic
1042910364 8:73820021-73820043 CAGGAGTTTTGGGACCAGCCTGG - Intronic
1045048758 8:98303680-98303702 CAGGAGTTTGGAGACCAGCTTGG + Intergenic
1045385639 8:101668631-101668653 CAGCAGCTTGGGGACCCTCCAGG + Exonic
1048345095 8:133570238-133570260 GCGGGGCTTGGGGACCCGCGAGG + Intronic
1049145856 8:141000900-141000922 GAGGAGGTTGGGGGCCCTCGCGG - Intronic
1049638888 8:143705487-143705509 CAGGAGCTTGAGGACCCCCAGGG - Intronic
1059119205 9:111627032-111627054 CAGGAGCCTGGGGAGAGGCGTGG - Intergenic
1060985878 9:127818674-127818696 CAGGAGCTGGGAGGCCCGAGGGG + Intronic
1061422164 9:130478344-130478366 CAGGAGCCTGGAGAGCCGTGAGG + Intronic
1061807716 9:133145679-133145701 CAGGAGCTTGGTGACCCAGATGG - Intronic
1062527876 9:136985560-136985582 CAGCAGCCTGGGGAACCGCGGGG + Exonic
1062737782 9:138147831-138147853 CCGGAGCTTTGGGACACCCGGGG + Intergenic
1185453252 X:294126-294148 CAGGAGTTTGGAGACCAGCCTGG + Intronic
1187362860 X:18644357-18644379 CAGGAGCTCGGGGACAGGAGGGG + Intronic
1187767062 X:22654263-22654285 CAGTAGTTTGGGGACCCCTGGGG + Intergenic
1195664856 X:107419885-107419907 CAGGAGCAGGGGTACCCTCGAGG - Intergenic
1195686551 X:107592098-107592120 CTGGACCTTGGGGACTTGCGGGG - Intronic