ID: 968674593

View in Genome Browser
Species Human (GRCh38)
Location 4:1870938-1870960
Sequence AGGAGCTTGGGGACCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968674586_968674593 -8 Left 968674586 4:1870923-1870945 CCCCTCTCACGGGACAGGAGCTT No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674572_968674593 27 Left 968674572 4:1870888-1870910 CCGCTAGCAGCCTCCCGCGGGCC 0: 1
1: 0
2: 1
3: 10
4: 175
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674579_968674593 4 Left 968674579 4:1870911-1870933 CCAGGCCCCGCGCCCCTCTCACG No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674583_968674593 -2 Left 968674583 4:1870917-1870939 CCCGCGCCCCTCTCACGGGACAG No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674584_968674593 -3 Left 968674584 4:1870918-1870940 CCGCGCCCCTCTCACGGGACAGG No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674578_968674593 5 Left 968674578 4:1870910-1870932 CCCAGGCCCCGCGCCCCTCTCAC No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674575_968674593 14 Left 968674575 4:1870901-1870923 CCCGCGGGCCCCAGGCCCCGCGC 0: 1
1: 1
2: 5
3: 65
4: 564
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674577_968674593 6 Left 968674577 4:1870909-1870931 CCCCAGGCCCCGCGCCCCTCTCA No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674576_968674593 13 Left 968674576 4:1870902-1870924 CCGCGGGCCCCAGGCCCCGCGCC No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674582_968674593 -1 Left 968674582 4:1870916-1870938 CCCCGCGCCCCTCTCACGGGACA No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674588_968674593 -10 Left 968674588 4:1870925-1870947 CCTCTCACGGGACAGGAGCTTGG 0: 1
1: 0
2: 2
3: 6
4: 120
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674574_968674593 17 Left 968674574 4:1870898-1870920 CCTCCCGCGGGCCCCAGGCCCCG No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data
968674587_968674593 -9 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674593 4:1870938-1870960 AGGAGCTTGGGGACCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968674593 Original CRISPR AGGAGCTTGGGGACCCGCGC GGG Intergenic
No off target data available for this crispr