ID: 968674599

View in Genome Browser
Species Human (GRCh38)
Location 4:1870969-1870991
Sequence GCGCCCAACGCCAGCCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968674588_968674599 21 Left 968674588 4:1870925-1870947 CCTCTCACGGGACAGGAGCTTGG 0: 1
1: 0
2: 2
3: 6
4: 120
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674582_968674599 30 Left 968674582 4:1870916-1870938 CCCCGCGCCCCTCTCACGGGACA No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674596_968674599 -5 Left 968674596 4:1870951-1870973 CCCGCGCGGGCGGGCCGCGCGCC No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674597_968674599 -6 Left 968674597 4:1870952-1870974 CCGCGCGGGCGGGCCGCGCGCCC No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674584_968674599 28 Left 968674584 4:1870918-1870940 CCGCGCCCCTCTCACGGGACAGG No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674587_968674599 22 Left 968674587 4:1870924-1870946 CCCTCTCACGGGACAGGAGCTTG No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674583_968674599 29 Left 968674583 4:1870917-1870939 CCCGCGCCCCTCTCACGGGACAG No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data
968674586_968674599 23 Left 968674586 4:1870923-1870945 CCCCTCTCACGGGACAGGAGCTT No data
Right 968674599 4:1870969-1870991 GCGCCCAACGCCAGCCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968674599 Original CRISPR GCGCCCAACGCCAGCCTCCG CGG Intergenic
No off target data available for this crispr