ID: 968675826

View in Genome Browser
Species Human (GRCh38)
Location 4:1878775-1878797
Sequence GAGCCTTATGCACCATTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968675825_968675826 5 Left 968675825 4:1878747-1878769 CCATGGGCTGGTGGCAGAGGTCA 0: 1
1: 0
2: 3
3: 37
4: 312
Right 968675826 4:1878775-1878797 GAGCCTTATGCACCATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968675826 Original CRISPR GAGCCTTATGCACCATTAGC AGG Intronic
No off target data available for this crispr