ID: 968676244

View in Genome Browser
Species Human (GRCh38)
Location 4:1882086-1882108
Sequence CTGTAGATTGAGTTGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968676244 Original CRISPR CTGTAGATTGAGTTGGTGCT GGG Intronic
903764568 1:25725851-25725873 CTGAAGAATGAGAGGGTGCTCGG + Intronic
905918023 1:41699330-41699352 GTGTAGAATGAGTAGGTTCTGGG - Intronic
909252010 1:73370446-73370468 CTCTATATTGAGTGGGTGGTGGG - Intergenic
910758568 1:90714641-90714663 CAGTTGATTGAGCTGGTGGTCGG + Exonic
913090668 1:115474665-115474687 CTGCTGGTTGAGTAGGTGCTTGG - Intergenic
915465811 1:156097288-156097310 CTGCAGAGTGACCTGGTGCTGGG + Intronic
917229383 1:172819623-172819645 CTCTAGATTGAGGTGGATCTTGG + Intergenic
919759789 1:201090368-201090390 ATGTAGATTGTGGTGGTGATGGG + Intronic
923637073 1:235709146-235709168 CAGTGGATTGACTTGGTGTTTGG - Exonic
924169978 1:241328806-241328828 CTGTAGATTTATTTGGGGGTAGG - Intronic
924321438 1:242854958-242854980 CTTTAGATTGTGTGGGAGCTGGG - Intergenic
1062781306 10:211304-211326 CTATAGATTGAGTTTGTGAAAGG + Intronic
1064612008 10:17113550-17113572 CTGGAGATTCAGTTGCTGCAGGG + Intronic
1064933941 10:20658983-20659005 CTGTAAATAGAGTTGGTTATAGG + Intergenic
1068648530 10:59496176-59496198 CTGAAGATTTAGTTGGGACTAGG + Intergenic
1068798750 10:61115047-61115069 CTGTAGATTGAGGTGGAGATAGG + Intergenic
1074656584 10:115596062-115596084 ATGTATATTGTGTTGGTGTTCGG + Intronic
1075515451 10:123104556-123104578 CTGGAGATGGAGTTGGGGCCTGG + Intergenic
1077634014 11:3829628-3829650 CTGGAGATTCAGTTGGACCTGGG + Intronic
1078161130 11:8840494-8840516 CTGTTCATTGCGTTGGTGCTGGG - Intronic
1078790058 11:14533300-14533322 CTCCACATTGATTTGGTGCTGGG + Intronic
1080507638 11:32932611-32932633 CTGTAGAATAAATTTGTGCTTGG - Exonic
1081103049 11:39028958-39028980 CTGGAGCTTGAGCTGGTGCAGGG + Intergenic
1084270347 11:68026191-68026213 CTCTACATTGAGGTGGGGCTGGG - Intronic
1086300325 11:85420742-85420764 CTGAAGCTTGAGTAGGTGGTTGG - Intronic
1086921197 11:92589104-92589126 CTGTAGTTGTAGTTGATGCTGGG + Intronic
1088545332 11:110953350-110953372 CTGTTGGCTGAGCTGGTGCTTGG + Intergenic
1089878857 11:121753946-121753968 GTGTATCTTGAGTTGGGGCTGGG + Intergenic
1091671586 12:2456061-2456083 TTGAAGTTTGAGTTGTTGCTTGG - Intronic
1093539858 12:20268596-20268618 CTGCAGGTTGACTTTGTGCTCGG - Intergenic
1093655593 12:21690435-21690457 ATGTATATTCAGTTGTTGCTGGG - Intronic
1094366320 12:29686526-29686548 CTGTAGATGGAGCTGATGCTGGG + Intronic
1096504172 12:52082270-52082292 GTGTAGAGTGATTTGGTGCCGGG + Intergenic
1096716992 12:53497622-53497644 CTGTTGACTGAGGTGATGCTGGG - Intronic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1097579268 12:61433629-61433651 CTGTACAATGAATTGTTGCTTGG - Intergenic
1100475361 12:94930606-94930628 CAGGAGATTGAGCTGCTGCTTGG + Intronic
1107276472 13:38686201-38686223 AAGTAGATTTAGTTTGTGCTTGG + Intergenic
1109317514 13:60767752-60767774 CTGGGGATTGAGATGGTGGTGGG - Intergenic
1118532232 14:66719012-66719034 CTGTGGATTGCGTGGGAGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120770930 14:88379889-88379911 CAGTAGATTGAGTTGGAGGGTGG - Intergenic
1121071909 14:91031231-91031253 TTGTAGATTGAATTGTTACTTGG - Intronic
1121808412 14:96855191-96855213 CTTTAGTTTGTCTTGGTGCTTGG + Intronic
1126419316 15:48454873-48454895 CTGGTGAGTGAGGTGGTGCTGGG - Intronic
1129542422 15:76361475-76361497 TGGTAGATTGAGTTGGAGCTTGG - Intronic
1129677771 15:77641710-77641732 CTGTGGAGTCAGGTGGTGCTGGG + Intronic
1130879713 15:88044581-88044603 ATGTAGGTTGAGGTGGTGGTGGG - Intronic
1132505849 16:308325-308347 CTGTGGAGTGCGTTGGTGCCTGG - Intronic
1134824956 16:17277133-17277155 CTGTTTATTGAGTTGTTGGTAGG - Intronic
1136037190 16:27549536-27549558 CTGTTGATTGAGTTGGGGCACGG - Intronic
1143949451 17:10621118-10621140 CAGTAGGTTGGGTTGGAGCTGGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1153716369 18:7853364-7853386 TTGCAGGTGGAGTTGGTGCTAGG + Intronic
1153795236 18:8615752-8615774 ATGCAGATTTAGTTGGTGTTAGG + Intronic
1155735557 18:29218422-29218444 CTGGAGTGTGAGTGGGTGCTAGG + Intergenic
1159861757 18:73657726-73657748 CTATAAATTTAGTTGTTGCTAGG - Intergenic
1162616762 19:11807763-11807785 CTGCAGATTGAGTTGGTAGGAGG + Exonic
1164576325 19:29407374-29407396 CTGTAGAGTGAGTGGGTGGGTGG + Intergenic
1165576934 19:36827984-36828006 CTGTAGTATGAATTGGTCCTAGG + Intronic
1167558645 19:50211684-50211706 CTTAAGATTGAGATGGGGCTGGG + Intronic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
926557136 2:14371894-14371916 CTGTAAATTGCTTTGTTGCTTGG - Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
935472905 2:103480698-103480720 TTGTCGATTGTGGTGGTGCTAGG + Intergenic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
941180232 2:162250923-162250945 CTATAGATGGAATTTGTGCTTGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
943329692 2:186543791-186543813 TTGTATATGGAGTTGTTGCTTGG - Intergenic
948540379 2:238687053-238687075 CTGTTGATTTAGCAGGTGCTGGG - Intergenic
949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG + Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1169216792 20:3798893-3798915 CTGCAGATTGATTTGGCTCTTGG + Intronic
1169698427 20:8418343-8418365 CTGAAGGTTGGGCTGGTGCTAGG - Intronic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1177973808 21:27823485-27823507 CTGTAAAGTGATTTGATGCTTGG - Intergenic
1179633189 21:42691247-42691269 CTTTAGATGGAGATGGTGATGGG - Intronic
1183271610 22:36865787-36865809 CTGGAGATGGGGTTGGAGCTTGG - Intronic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1185014781 22:48336489-48336511 CTGTTGACTGAGTTGTTGGTTGG + Intergenic
951078289 3:18424070-18424092 CTGTACACTGTGATGGTGCTGGG + Exonic
952674809 3:36015208-36015230 ATTTAGATTCAGTTTGTGCTAGG + Intergenic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
957935188 3:86933314-86933336 TAGTAGATTGAGATGGAGCTTGG + Intergenic
960531684 3:118772579-118772601 CTCTAGATTGGGGAGGTGCTGGG - Intergenic
966399357 3:179532640-179532662 CTGTACATGGTGTTGGTGCAGGG - Intergenic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
970363797 4:15337660-15337682 TTGTAGGTGGAGTTGGTTCTTGG + Intergenic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
971225950 4:24751757-24751779 CTGGAGAATGAGTTGGTGTTAGG - Intergenic
972761821 4:42113782-42113804 CTGTAGAGTTAGTGGGTGATCGG - Exonic
972834473 4:42853262-42853284 CTGGAGATGTAGTTGGTGGTTGG - Intergenic
974406786 4:61482852-61482874 CTCTAGAATGGGTTGCTGCTTGG + Intronic
977564439 4:98567126-98567148 CTGTTGATGGATTTTGTGCTGGG - Intronic
985969751 5:3365749-3365771 CTGCAGATAGCCTTGGTGCTTGG + Intergenic
986968937 5:13309255-13309277 ATGTAGAGTGAGCTGATGCTAGG - Intergenic
987037578 5:14033452-14033474 CTGTAGATACAGCTGGTCCTGGG - Intergenic
988125802 5:27034215-27034237 CTGTAAATTGAATTAGTGTTTGG + Intronic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
990642418 5:57802206-57802228 CTGTGGTTTGAGTGTGTGCTTGG + Intergenic
994935842 5:106252704-106252726 GTGAAGTTTGAGTTGGAGCTCGG + Intergenic
995153341 5:108878602-108878624 CCATTGATGGAGTTGGTGCTAGG + Intronic
996110392 5:119559160-119559182 CTGTAGTCTGAGAGGGTGCTTGG - Intronic
999073763 5:148775347-148775369 CTAAAAATTGAGTTGGTGTTGGG + Intergenic
1005634806 6:27743386-27743408 CTGTCGATTGAGATGGGGCCAGG - Intergenic
1009409277 6:63346825-63346847 CTGGAGATTGAGTTAATGCTCGG + Intergenic
1012088516 6:94860224-94860246 CTGGGGATTGGATTGGTGCTTGG - Intergenic
1012522075 6:100134104-100134126 CTGTAGACTTACTTGGTGCTTGG - Intergenic
1014489320 6:122042779-122042801 CTGGAACTTGAGATGGTGCTTGG - Intergenic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1021941102 7:25679695-25679717 TAGTACATTGAGTTGGGGCTGGG - Intergenic
1024563433 7:50663170-50663192 CTGCAGAGTGAGATGCTGCTGGG + Intronic
1027573894 7:79907459-79907481 CTGTATGTTGAGGTGGTGGTGGG + Intergenic
1028243900 7:88452911-88452933 CTGCAGGGAGAGTTGGTGCTGGG + Intergenic
1032221389 7:129997149-129997171 TTCTAGTTTGAGTTGGTGTTTGG + Intergenic
1033815496 7:145067865-145067887 TTGTAGATTGAGTTGGGGAGTGG + Intergenic
1040060275 8:43097781-43097803 CTGTAACTTGAGTGGGTGGTTGG + Intronic
1041724325 8:61004287-61004309 CTGCAGATTGAAGTGGTCCTGGG - Intergenic
1042757014 8:72225910-72225932 CTGTAGATTTAGTTCCTCCTTGG - Intergenic
1044323165 8:90829198-90829220 CTATAGATTTAGTTTTTGCTAGG - Intronic
1047340767 8:123978064-123978086 CTGTGGTTTGAGTTGGTTCAGGG + Intronic
1050004483 9:1115616-1115638 CTGTGGATTAAGTTGGTGAAAGG + Intergenic
1051441918 9:17093830-17093852 CTGTGAAGTGACTTGGTGCTGGG - Intergenic
1053163123 9:35827438-35827460 CTCTAGATTGAGTTGAGTCTAGG + Intronic
1186600500 X:11031608-11031630 TTGTAGAATGAGTTAGTGATCGG - Intergenic
1189642294 X:43085922-43085944 CTGCAGAATGATGTGGTGCTTGG - Intergenic
1189680169 X:43507703-43507725 CTGAAGCTGGCGTTGGTGCTGGG - Intergenic
1194950810 X:100123467-100123489 CAGTAGAAGGAGGTGGTGCTGGG - Intergenic
1195464940 X:105169914-105169936 CTATAAATTGAGTTGGTCCTAGG + Intronic
1195814915 X:108874176-108874198 CTGTAGCTTGAGTATGTGGTAGG - Intergenic