ID: 968678508

View in Genome Browser
Species Human (GRCh38)
Location 4:1899387-1899409
Sequence GGGCGGACCCTGACCTCTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968678508_968678520 29 Left 968678508 4:1899387-1899409 CCATCAGAGGTCAGGGTCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 968678520 4:1899439-1899461 GATGAGGTTAAGTGTCCCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 136
968678508_968678516 13 Left 968678508 4:1899387-1899409 CCATCAGAGGTCAGGGTCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 968678516 4:1899423-1899445 ATAAAAAATGCTTCCAGATGAGG 0: 1
1: 0
2: 3
3: 45
4: 423
968678508_968678518 27 Left 968678508 4:1899387-1899409 CCATCAGAGGTCAGGGTCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 968678518 4:1899437-1899459 CAGATGAGGTTAAGTGTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 93
968678508_968678519 28 Left 968678508 4:1899387-1899409 CCATCAGAGGTCAGGGTCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 968678519 4:1899438-1899460 AGATGAGGTTAAGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968678508 Original CRISPR GGGCGGACCCTGACCTCTGA TGG (reversed) Exonic
900613141 1:3552935-3552957 GGACTGAGCCTGAACTCTGAGGG - Intronic
905890269 1:41514496-41514518 TGGCGGACTCTGGCCTCTGTGGG + Intronic
906511439 1:46412337-46412359 GGGAGGACCCTGCCCTCTCGGGG + Intronic
912459319 1:109820471-109820493 GGGTGGTCCCTGCCCTTTGAGGG + Intergenic
912650218 1:111431800-111431822 AGGCGGTCCGTGACTTCTGATGG - Intergenic
915170301 1:153972872-153972894 GGCCTCACCATGACCTCTGAGGG + Intronic
916595366 1:166237278-166237300 GGAGGGACCCTGTCCTCTCAGGG - Intergenic
922223381 1:223625915-223625937 TGGCTGACCCTGACCTCTCAGGG + Intronic
922721470 1:227902168-227902190 TGGCTTACCCTGACCCCTGATGG + Intergenic
922899139 1:229122874-229122896 GGCAGGACCATGACCTCTGTTGG - Intergenic
923323267 1:232857502-232857524 AGGTAGACCCTGACCTCTCAGGG - Intergenic
1067142538 10:43669101-43669123 GGCCTGCCCCTGCCCTCTGATGG - Intergenic
1070972714 10:80580746-80580768 TGGCAGACCCTGGCCTCTGTGGG + Intronic
1071963579 10:90830960-90830982 TGGCAGAGCCTGAACTCTGAAGG - Intronic
1076373045 10:129967179-129967201 GGGCGGAGCCTGACCTTTGCCGG + Intergenic
1076774338 10:132686091-132686113 GGTGGGACCCTGGTCTCTGAAGG - Intronic
1076800823 10:132827258-132827280 GGGCTGACCGTGGCCTGTGATGG + Intronic
1078464629 11:11541198-11541220 GGGCTGACCCTGATTCCTGAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084512745 11:69616335-69616357 GGGTGGACGCTGACTGCTGAGGG + Intergenic
1096975696 12:55698301-55698323 GACCACACCCTGACCTCTGAGGG + Intronic
1098175434 12:67785472-67785494 GGAGGGACCCTAACCTATGAGGG + Intergenic
1102185236 12:110942417-110942439 GGGCTGACCTGGAACTCTGAGGG + Intergenic
1104721209 12:131046101-131046123 GGGAGGACACTGACCTGGGAGGG - Intronic
1119367441 14:74106157-74106179 GGGAGGACTCTGAGCTCAGATGG - Intronic
1122977238 14:105175864-105175886 GAGCGGGCCCTGGCCTCTGGAGG + Intronic
1123040466 14:105488228-105488250 GGGAAGACGCTGACCTCTGGGGG + Exonic
1123587396 15:21772487-21772509 GGGGGTACCCTGACCTTTTAGGG + Intergenic
1123624034 15:22215052-22215074 GGGGGTACCCTGACCTTTTAGGG + Intergenic
1124983571 15:34584403-34584425 GAGAGGACCCTGACCTCCGCGGG + Intronic
1134216410 16:12320165-12320187 GGGCCGACCCTGACTTCCCAGGG + Intronic
1136065200 16:27753980-27754002 GGGCGGACCCTGACCCTCCAGGG - Intronic
1138353641 16:56360697-56360719 GGGCTGCCCCTGGCCTCTGTGGG - Intergenic
1139598174 16:67969811-67969833 GGCCGGACCCCGACCTCTGCAGG + Intergenic
1140704715 16:77616536-77616558 GTGCGCACCATGACCTGTGAAGG - Intergenic
1144941940 17:18948091-18948113 GGGAGGACCCTGAGCTCAGCCGG - Intergenic
1146517672 17:33502047-33502069 GGGTGGACCCTGACACCTGAAGG + Intronic
1147599675 17:41738164-41738186 GGGCTGACACTGCCCTCTGGTGG - Intergenic
1147914055 17:43876322-43876344 GGGGGGAGCCTGTCCTCAGAGGG - Intronic
1148136225 17:45293628-45293650 AGGCTGACCCTCACCTCTCAGGG + Intronic
1148209701 17:45800732-45800754 GTGCGGTCCCTGACCCCTGGGGG + Intronic
1151328526 17:73393465-73393487 GGGCAGAGCCTGACCCCAGAAGG + Intronic
1155166658 18:23237489-23237511 TGGGGGACCCTCTCCTCTGAAGG + Intronic
1161257487 19:3317406-3317428 GGGCAGAGCCTGGCCTCTGCAGG + Intergenic
1161685059 19:5698474-5698496 GGGAGGGCGCTGAACTCTGAGGG + Intronic
1162065249 19:8121449-8121471 GGGGGGTCCCTGTCCTTTGATGG + Intronic
1162757170 19:12867353-12867375 GGGCGGAGCCAGGCCTCGGAGGG + Intronic
1163747082 19:19055001-19055023 AGGGGGACCCTGTGCTCTGAAGG + Intronic
1165425773 19:35744711-35744733 GGGCGGGGCCTGAGCTCAGAGGG + Exonic
1166059720 19:40318650-40318672 GGGCGGCCCCTGGAATCTGAGGG + Intergenic
1167871367 19:52373252-52373274 GGGCAGATCTTGACTTCTGAAGG - Intronic
925159882 2:1676503-1676525 GGAGGGGCCCTGACCTCTGCTGG - Intronic
925583967 2:5444157-5444179 GGGCGGCCTCTGACCTCAGTGGG + Intergenic
929810911 2:45188627-45188649 TGGCTGCCCCTGACCTCTGCAGG + Intergenic
944115594 2:196183056-196183078 GACTGAACCCTGACCTCTGATGG - Intergenic
1172438962 20:34951947-34951969 AGCAGGACCCTGACCTCTGTTGG + Intronic
1173136685 20:40444916-40444938 GGGCTGACCCTGTGCTCAGATGG - Intergenic
1175796145 20:61772259-61772281 GGGCGGAGGCTGACGGCTGAGGG - Intronic
1175828488 20:61949949-61949971 AGGCGGGTCCTGACCACTGAGGG - Intergenic
1176159167 20:63639988-63640010 GGGAGGATCCTGACCCCTGCAGG - Exonic
1176309217 21:5140952-5140974 ACGCTGGCCCTGACCTCTGATGG - Exonic
1179847844 21:44121081-44121103 ACGCTGGCCCTGACCTCTGATGG + Exonic
1181778674 22:25177937-25177959 GGGAGGATCCTGACCCCTGCAGG - Intronic
1182257679 22:29050256-29050278 GGGCCGCCCCTGACCTCAGGAGG + Exonic
1185247532 22:49781117-49781139 GGGTGGACCCTGGCCGCTGTGGG - Intronic
950316399 3:12004949-12004971 CGGCGGACCCCGACCCCCGAGGG - Intronic
950415919 3:12869067-12869089 GGGCTGAGCCTGATTTCTGAGGG - Intronic
950417367 3:12876182-12876204 GGGCTGAGCCTGATTTCTGAGGG - Intergenic
950610560 3:14124407-14124429 GCCCGAACCCTGACCTCAGAGGG - Intronic
951719833 3:25686997-25687019 GGGAAGACGCTGACCTCCGAGGG + Intergenic
956179686 3:66505501-66505523 AGGCAGTCCCTTACCTCTGACGG + Intergenic
956518630 3:70079415-70079437 GGATGGACCCTGACTTATGATGG + Intergenic
961512152 3:127409623-127409645 GGGCCTGCCCTGACCTCAGAGGG - Intergenic
965714302 3:171586340-171586362 GTTAGGACCCAGACCTCTGAGGG - Intergenic
968678508 4:1899387-1899409 GGGCGGACCCTGACCTCTGATGG - Exonic
969306325 4:6328081-6328103 GGGCTCTCCCAGACCTCTGAGGG - Intronic
986267351 5:6202106-6202128 GGCCAGACTCTGACATCTGATGG + Intergenic
998523562 5:142821957-142821979 GGGCTGACCCAGCCCTTTGAGGG + Intronic
998583276 5:143402960-143402982 GGGAGGAACCTGACCTCGGACGG - Intronic
998878254 5:146621485-146621507 TGGCGGCCCCACACCTCTGAAGG + Intronic
1003094060 6:3128636-3128658 GAGGGGACCCTGAGCTCTGCTGG - Intronic
1012873383 6:104697445-104697467 GGAAGGCCCCTGACATCTGAGGG + Intergenic
1032737107 7:134702555-134702577 GGGCGGGACCGGACCTCTCATGG - Intergenic
1035031261 7:155862624-155862646 GGGCTGACCCTGACTTTGGAGGG + Intergenic
1035035124 7:155889812-155889834 GGGCTGGCCATGACCTCTGGGGG + Intergenic
1035407068 7:158606051-158606073 GGGGGTCCCCTGCCCTCTGAGGG - Intergenic
1035680131 8:1481926-1481948 GGGGGGACCCTGGCATCAGAAGG - Intergenic
1039621153 8:38997482-38997504 GGGCGGGCGCTGACCTCGGCGGG + Intronic
1052357884 9:27524781-27524803 TGGGGGACCCTGGCTTCTGAGGG - Exonic
1056444435 9:86652194-86652216 GGGGGGTCCCTGACTTATGATGG + Intergenic
1056470940 9:86903915-86903937 GGGTGGGCCCTGAACCCTGAAGG - Intergenic
1191254080 X:58272356-58272378 AGGAAGGCCCTGACCTCTGACGG + Intergenic
1191254400 X:58273562-58273584 GGGAAGGCCCTGACCTCTGGCGG + Intergenic
1194268033 X:91779134-91779156 GGGCGGCCCCTCCCCGCTGACGG - Intergenic
1200585236 Y:5000055-5000077 GGGCGGCCCCTCCCCGCTGACGG - Intergenic