ID: 968679272

View in Genome Browser
Species Human (GRCh38)
Location 4:1905487-1905509
Sequence CGCTGCCCCCACAGGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968679272_968679276 25 Left 968679272 4:1905487-1905509 CCTGAGCTCCTGTGGGGGCAGCG 0: 1
1: 0
2: 0
3: 22
4: 229
Right 968679276 4:1905535-1905557 TCTTTGTACTGCCACCTGCATGG 0: 1
1: 0
2: 1
3: 23
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968679272 Original CRISPR CGCTGCCCCCACAGGAGCTC AGG (reversed) Intronic
900136652 1:1120479-1120501 AGCTTCCCCCAGCGGAGCTCAGG - Intergenic
900151391 1:1180694-1180716 CGCTCCCTCCACACGAGCCCTGG + Intronic
900250400 1:1665794-1665816 CGCTGCTTCCACAGGACCCCAGG - Exonic
900316533 1:2059959-2059981 CGGAGCCCCCACACCAGCTCAGG - Intronic
900404191 1:2485360-2485382 CCCTGTCCCCACTGGGGCTCCGG - Intronic
901059712 1:6466295-6466317 CGCTGCCGCCTAATGAGCTCAGG - Exonic
901440223 1:9273254-9273276 CGCTGGCCCCACACCCGCTCAGG - Intergenic
901640061 1:10688602-10688624 CGCTGCCAACACAGGGGCCCGGG + Intronic
903466303 1:23554713-23554735 CGCTGCCCCCAGCTGCGCTCGGG - Intergenic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
905802614 1:40854853-40854875 CTCTTCCCACAGAGGAGCTCAGG + Intergenic
906265246 1:44424039-44424061 CGCTCTACACACAGGAGCTCAGG - Intronic
906960183 1:50415473-50415495 CGCTGATCCCAGCGGAGCTCAGG + Intergenic
907403193 1:54238365-54238387 CCTTGCCCCTCCAGGAGCTCAGG - Intronic
907627555 1:56044900-56044922 AGTTGCCACCACAGTAGCTCTGG + Intergenic
914445559 1:147747736-147747758 AGCTGTCCCCTCAGGTGCTCAGG + Intergenic
917846668 1:179025957-179025979 CGCCGCCGCCACAGCGGCTCCGG - Exonic
919913766 1:202127903-202127925 AGCTGCCACAGCAGGAGCTCAGG - Exonic
920201666 1:204263307-204263329 CTCTGGCCCCACAGAGGCTCCGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921260015 1:213378036-213378058 AGCTGCCCTAACAGGAGCTGGGG - Intergenic
922586331 1:226737249-226737271 CGCTGTCCCCCGAGGAGCCCCGG - Exonic
922804364 1:228377933-228377955 CCCTGGCCCTCCAGGAGCTCTGG - Exonic
922842029 1:228650404-228650426 CGCTGACCCCACAGCCGCCCCGG - Intergenic
1062816583 10:505580-505602 CCCTGACCCCACAGGAGATGGGG + Intronic
1067058197 10:43064544-43064566 GGCTGACCCAGCAGGAGCTCAGG + Intergenic
1069813570 10:71179680-71179702 TGCTGCCCCCACAGCAGGGCTGG - Intergenic
1069993907 10:72331264-72331286 CGCAGCCCCCACGGGGGCTGAGG - Intergenic
1072034069 10:91548587-91548609 AGATGCCCCCACAGGAGAGCCGG - Intergenic
1073462770 10:103676262-103676284 GGCTGCCCCCACACGTGTTCTGG - Intronic
1074382604 10:112992588-112992610 CTCTTCCCTCCCAGGAGCTCCGG - Intronic
1076004240 10:126935382-126935404 GGCAGCCCCCAGAGGAGTTCTGG + Intronic
1076501934 10:130944003-130944025 CGCTGTCCCCAGAGGAGATGAGG + Intergenic
1076715283 10:132360897-132360919 CGCTGACCCCTCCGGACCTCAGG - Intronic
1076729449 10:132431141-132431163 CGCTGGGCCCCCAGCAGCTCAGG + Intergenic
1077066980 11:645711-645733 TGCTGACCTCACAGGAGCTGTGG - Intronic
1078143416 11:8707559-8707581 CACTGCCAGCACAGGAGCTGGGG + Intronic
1079182905 11:18209326-18209348 CTCTGCTCCCTCCGGAGCTCAGG - Exonic
1081623302 11:44631934-44631956 TGCTGCCCTCTCCGGAGCTCTGG - Intergenic
1083097743 11:60268838-60268860 CACTGCCCCCTCAGAAGCACAGG + Intergenic
1083600622 11:63945334-63945356 CCCGGCTCCCACAGGAGCTGTGG + Intronic
1083610023 11:64000134-64000156 TGCGGCCCCCACAGGAGTGCTGG - Intronic
1083659492 11:64245608-64245630 AGCTGCACCCACCGGTGCTCTGG - Intronic
1083849059 11:65354889-65354911 CGCCGCCCGGACAGGGGCTCGGG + Exonic
1084477136 11:69395492-69395514 CCCTGCCCACACACGAACTCTGG - Intergenic
1085197082 11:74679302-74679324 CACTGTCCCCACAGTACCTCAGG - Intergenic
1085505029 11:77053517-77053539 GGCTGCATCCACAGGAGCTTAGG + Intergenic
1088788747 11:113205544-113205566 CGCCAACCCCACAGGAGTTCCGG + Exonic
1089370313 11:117950855-117950877 AGGTGCCACCACAGTAGCTCTGG - Intergenic
1089497441 11:118914757-118914779 AGCTGCTCCCAGAGGAGGTCTGG + Intronic
1089610186 11:119664600-119664622 CCCTGGCCCCCCAGGAGTTCGGG + Exonic
1092523444 12:9295177-9295199 AGCTGTCCTCACAGCAGCTCAGG + Intergenic
1092543852 12:9436722-9436744 AGCTGTCCTCACAGCAGCTCAGG - Intergenic
1096559367 12:52424672-52424694 CGCTGCCCCCACCGAGGCCCAGG + Exonic
1096626670 12:52900057-52900079 CTCTTCCCCCACAGGAGATCCGG - Exonic
1097284237 12:57865377-57865399 CGCTTCCCCCGCCGGAGCGCCGG + Intergenic
1097379215 12:58875164-58875186 GGCTGCTCCCAGAGTAGCTCTGG - Intronic
1100839059 12:98593788-98593810 CAGCGGCCCCACAGGAGCTCTGG - Intronic
1101969116 12:109300392-109300414 AGCTGTCCCCACAGGCTCTCAGG - Intronic
1102454373 12:113062795-113062817 CTCTGGCCCCACAGGGGCTGCGG + Intronic
1102877100 12:116457251-116457273 CGCTACCCCCACAGGACATTTGG - Intergenic
1103528203 12:121581241-121581263 CGCAGCCCGCACAGGAGCGAAGG + Intergenic
1103955303 12:124573078-124573100 CGCTGCCACCTCAAGAGCCCTGG + Intergenic
1104751933 12:131245421-131245443 CGCTGCCCACACAGGACTCCGGG + Intergenic
1105407408 13:20143593-20143615 GGCTGACCCTACAGGAGCTCTGG + Intronic
1105782926 13:23720205-23720227 AGCTGCCCCCCAAGGAGCACAGG - Intergenic
1105913238 13:24890746-24890768 CTCTGCCCTCACAGGAGCCTGGG + Intronic
1110190776 13:72727196-72727218 CGCTGTCACCGCAGGAGATCGGG + Intronic
1112533127 13:100224120-100224142 CTCTGGCCCCACAGGAGCCCAGG + Intronic
1113714297 13:112492532-112492554 CTCTCCCCCCAGAGGAGCCCTGG + Intronic
1114270577 14:21098119-21098141 CCCCGCCCCCCCAGGAGCTCTGG + Intronic
1114977734 14:28123096-28123118 TGCTGCCTCCCCCGGAGCTCAGG + Intergenic
1119480364 14:74954714-74954736 CCCTGCCCCCACCAGGGCTCAGG - Intronic
1123052957 14:105555972-105555994 AGCTGCCCGCACAGGATCTGTGG - Intergenic
1123077540 14:105676362-105676384 AGCTGCCCGCACAGGATCTGTGG - Intergenic
1125513817 15:40307106-40307128 GGCTGCCCCCACAGCAGCGCAGG + Intronic
1125575874 15:40755147-40755169 CGCGGCCCCCGAAGGCGCTCTGG + Exonic
1126191673 15:45885287-45885309 AGCTGCCCTCACAGGAGGACGGG - Intergenic
1128155026 15:65386542-65386564 CGCAGCCCCCACAGGTGAGCAGG - Exonic
1128986860 15:72228700-72228722 TCCTGCCCCCACAGCACCTCAGG + Intronic
1129407327 15:75328191-75328213 CCCTGCCTCCAGAGCAGCTCTGG + Intergenic
1129530649 15:76261628-76261650 TGCTGCCGCCACAGCAGCTGGGG - Intronic
1129893794 15:79089539-79089561 CGCTGCCTCCGCAGCAGCCCTGG + Intronic
1130154743 15:81340083-81340105 AGCTGCCCTCAGGGGAGCTCTGG - Intronic
1131261397 15:90889908-90889930 CGCAGCTGCAACAGGAGCTCCGG + Exonic
1132111138 15:99103094-99103116 CGATGACACCACAGCAGCTCTGG + Intronic
1133232684 16:4373901-4373923 TGCTGCCCTCCCATGAGCTCAGG - Intronic
1137256266 16:46777985-46778007 CCCCGCCCCCACAAGAGCACAGG - Intronic
1137511804 16:49107216-49107238 AGTTAACCCCACAGGAGCTCTGG + Intergenic
1139649158 16:68353506-68353528 CGCAGTCACCACAGGGGCTCCGG - Exonic
1142173488 16:88634647-88634669 CTCTGCGCCCACAGGACCCCGGG + Intergenic
1143247630 17:5499983-5500005 TGCTGCGCCCCCAGGGGCTCCGG - Intronic
1143514517 17:7413160-7413182 TGCTGCCCACATAGAAGCTCTGG + Intronic
1143761234 17:9105552-9105574 CCCTGTCCCCACAGGAGCCAGGG - Intronic
1144107251 17:11997318-11997340 CGCTGGCCCCTCCGTAGCTCCGG + Exonic
1144758442 17:17694134-17694156 CGCTGCCCTCCCAGGAGACCCGG - Intronic
1145006842 17:19343118-19343140 CCCCTCCCCCACAGGAGCTGGGG - Intronic
1147364756 17:39952683-39952705 AGATGGCCCCACAGGAGCACAGG + Intergenic
1147683893 17:42275916-42275938 CGCCGACCCCATAGGAGCTCAGG - Intronic
1151095665 17:71494920-71494942 CTCTGCACCCACAGGAGGGCAGG + Intergenic
1151597018 17:75084478-75084500 CCCTGCCCCCACCGCAGCTCAGG + Intergenic
1151671511 17:75573938-75573960 CTCTTCCCCCACAGGAACTCAGG + Exonic
1151715747 17:75830265-75830287 CGCTCACCCTGCAGGAGCTCTGG - Intronic
1151802808 17:76387659-76387681 CTCCACCCCCACAGGAGCTGTGG - Exonic
1152552761 17:81038100-81038122 CCCTTCCTCCACAGGAGCCCGGG + Intronic
1152821545 17:82440113-82440135 CGCTGCTCCCTCAGGAGACCTGG - Intronic
1153480938 18:5545244-5545266 GGTTGCCCCTCCAGGAGCTCAGG + Intronic
1154332032 18:13437965-13437987 CACTGCCCACACAGTAGCACAGG - Intronic
1156371423 18:36474751-36474773 CGCTCCTGCCCCAGGAGCTCAGG - Intronic
1157564289 18:48669094-48669116 TGCTGCCCCCAGTGGTGCTCCGG + Intronic
1158437801 18:57446140-57446162 CACTGCCCTCCCAGGGGCTCGGG + Intronic
1160125231 18:76165615-76165637 GGCTGTCACCACAGGAGCTGTGG + Intergenic
1160594621 18:79964908-79964930 CGCAGGCCCCCCAGGACCTCAGG - Intronic
1160804239 19:984776-984798 CACTGCCCCCATAGCAGCTCAGG - Intronic
1161088327 19:2345153-2345175 CACGGCGCCCACAGGTGCTCAGG + Intronic
1161103231 19:2431700-2431722 CGGGGCCGCCACAGCAGCTCTGG - Intronic
1161233194 19:3185876-3185898 CGCGGTGCCCACAGGACCTCAGG + Exonic
1161594067 19:5142339-5142361 CGCTGTGGCCACAGGAGGTCGGG - Intronic
1162396588 19:10420852-10420874 GGCTGCCGCCACAGGTGCTGCGG - Exonic
1163002791 19:14379220-14379242 GGCCACCCCCACAGGAGCCCAGG + Intergenic
1163063958 19:14779519-14779541 GGCCACCCCCACAGGAGCCCGGG - Intergenic
1163711474 19:18849742-18849764 CTCTGACCCCACAGCAGCCCTGG + Intronic
1165046857 19:33111710-33111732 CTCTGCCCCCGCAGATGCTCTGG + Exonic
1165365878 19:35364309-35364331 CGCTGATCTGACAGGAGCTCAGG + Intergenic
1166033200 19:40148290-40148312 GGCTGCCCCCACAGGGACGCTGG + Intergenic
1166074158 19:40404147-40404169 CGCTGCCCTCGCAGGACGTCGGG + Intronic
1166524896 19:43504682-43504704 CTCGGCCCCCTCACGAGCTCAGG + Exonic
1166855671 19:45781691-45781713 AGCTGCCCCAACAGGTGCCCAGG - Intronic
1166938973 19:46351607-46351629 AGCTGCCCCATCAGGAGCGCGGG + Intronic
1167048229 19:47063947-47063969 CGTGGCCCGCACAGAAGCTCAGG + Intergenic
1167423481 19:49417245-49417267 GCCTGCCCCCACAGCGGCTCAGG + Exonic
1168121511 19:54254664-54254686 CCCTGCCCCCAGGAGAGCTCTGG - Intronic
1168133039 19:54332809-54332831 CCCTGCCCCCAGGAGAGCTCTGG - Intergenic
1168169462 19:54576158-54576180 CCCTGCCCCCAGCAGAGCTCTGG + Intronic
1168185779 19:54698546-54698568 CCCTGCCCCCAGCAGAGCTCTGG + Intronic
1168187755 19:54710457-54710479 CCCTGCCCCCAGGAGAGCTCAGG + Intergenic
925191940 2:1892192-1892214 TGCTGCCCCCGCCGCAGCTCAGG + Exonic
925552938 2:5095783-5095805 CCCAGCCCCAAAAGGAGCTCCGG + Intergenic
926110500 2:10180080-10180102 CCCTTCCCCCAGAGGAGGTCTGG + Intronic
927919640 2:26961996-26962018 CCCTGCCCCCAGAGCAGCTCAGG + Intergenic
929966010 2:46537245-46537267 CCCTGCCCCCACAGGGGCTGGGG - Intronic
932756901 2:74415448-74415470 CGCTTCCTCTACAGGACCTCCGG + Exonic
932791112 2:74654845-74654867 GGCAGCCCCCACCCGAGCTCTGG - Intronic
934948640 2:98560806-98560828 ATCTGCCCCCACAGAAGCTCAGG + Intronic
935499243 2:103818344-103818366 CTCTGCCCCCACAGGCATTCTGG - Intergenic
936981862 2:118272172-118272194 GGCTGCAGCCCCAGGAGCTCAGG - Intergenic
937383201 2:121400525-121400547 CCCTGCCCCCACAGGAGGTGAGG + Intronic
937871760 2:126791300-126791322 TGCAGCCCACACAGGAGCTGAGG - Intergenic
946016165 2:216605768-216605790 GGCTGCCCCCAAGGGAGCTGCGG - Intergenic
946047583 2:216833996-216834018 TGCCGCCCCTACATGAGCTCTGG - Intergenic
948053436 2:234994898-234994920 CGCTTTCTCCACAGGAGCTCTGG + Intronic
948682656 2:239646432-239646454 GGCTGCCCCCAGATCAGCTCTGG - Intergenic
948823928 2:240565373-240565395 GGCTGCCCACACAGGTGCTGTGG + Intronic
1168860553 20:1043415-1043437 CAGTGATCCCACAGGAGCTCTGG + Intergenic
1170278055 20:14615092-14615114 AGCTAACCCCACAGGAGCTCTGG + Intronic
1171110962 20:22482213-22482235 CCCAGCCCCCACAGGAGGCCAGG + Intergenic
1172650853 20:36500426-36500448 CGCTGCCCCCACCCGACCCCTGG + Exonic
1172656607 20:36541875-36541897 CCCAGCCCCCCCCGGAGCTCTGG - Intronic
1172999583 20:39095990-39096012 CTCTGCCTCCACAGGGGCCCTGG - Intergenic
1173355411 20:42283047-42283069 CGAGGCCCACACAAGAGCTCAGG - Intronic
1175121111 20:56716995-56717017 CTCTGCCCCCAGCGGATCTCCGG + Intergenic
1175657751 20:60786818-60786840 AGCTGACCGCACGGGAGCTCTGG - Intergenic
1175795358 20:61767331-61767353 TGCTGCCCCCACCGGGGCTGTGG + Intronic
1175844900 20:62053036-62053058 CCCTTCCCACACAGGAACTCTGG + Intronic
1175977282 20:62717283-62717305 CACAGCCCCCACAGGTGCACAGG - Intronic
1176147973 20:63573934-63573956 CTCTGCACCCACTGGAGCGCAGG - Intronic
1176195664 20:63835498-63835520 CCCTGGCCCCAGAGCAGCTCTGG - Intergenic
1176365943 21:6032894-6032916 CGCTGCTCCCCCAGAAGCACTGG - Intergenic
1179757573 21:43505651-43505673 CGCTGCTCCCCCAGAAGCACTGG + Intergenic
1180695117 22:17747008-17747030 TGCTGCCACCACAGCAGGTCAGG + Intronic
1181102860 22:20552962-20552984 CGCTGACCCCACAAGAGACCTGG - Intronic
1182666910 22:31966804-31966826 TACTGTCCCCACAGGAGCTCTGG + Intergenic
1183255182 22:36757401-36757423 CTCTCCCTCCACAGGAGCTAGGG - Intergenic
1183547322 22:38461445-38461467 GGCTGCCCCCCCAGTAACTCGGG - Intergenic
1184038245 22:41928653-41928675 GCCTGCCCCCAGAGCAGCTCAGG - Intergenic
1184130241 22:42513127-42513149 CCCTGCCCCCACAGCAGAGCTGG - Intronic
1184140417 22:42574950-42574972 CCCTGCCCCCACAGCAGAGCTGG - Intergenic
1184832213 22:46996072-46996094 CCCTGCCCCCTCAGGCGCACAGG + Intronic
1184838530 22:47038494-47038516 AGCTGCTCCCACAGGGCCTCAGG + Intronic
1185021501 22:48379401-48379423 GGCTGCACCTGCAGGAGCTCTGG - Intergenic
1185045516 22:48526582-48526604 GGATGCACCCGCAGGAGCTCCGG - Intronic
1185409286 22:50674059-50674081 CGCGGCCCCCACCCCAGCTCCGG + Intergenic
950404631 3:12796953-12796975 CGTGGTCCCCACTGGAGCTCCGG + Intronic
952593681 3:34988667-34988689 CTCTGGCCGCACAGGAGCCCAGG - Intergenic
952605676 3:35144737-35144759 GCCTGATCCCACAGGAGCTCTGG - Intergenic
953551767 3:43908690-43908712 TGCTGACCCCTTAGGAGCTCTGG - Intergenic
953699280 3:45183520-45183542 GGCTGCCCCCAGGGGAGCTGGGG + Intergenic
953907058 3:46873716-46873738 CACAGCCCCCACACCAGCTCAGG + Intronic
954439765 3:50515479-50515501 CTCTGCCCCCACAGTTGTTCTGG - Intergenic
954933622 3:54306660-54306682 CGCTGCCCTCTCAGGGCCTCAGG + Intronic
968648196 4:1750141-1750163 GGCTGAGCTCACAGGAGCTCTGG + Intergenic
968679272 4:1905487-1905509 CGCTGCCCCCACAGGAGCTCAGG - Intronic
968871991 4:3246955-3246977 CCCTGCGCCCACTGGAACTCGGG + Intronic
969599145 4:8165629-8165651 CCATGCCCACACAGCAGCTCTGG - Intergenic
971079962 4:23198476-23198498 CCCTTTCCCCTCAGGAGCTCAGG - Intergenic
980871235 4:138613580-138613602 CCCTACCCCCACAAGTGCTCAGG - Intergenic
981920391 4:150079108-150079130 TGCTGCCCCCGGAGGAGCTGGGG - Exonic
985550524 5:531295-531317 CCCTGGCCCCCCAGGGGCTCCGG + Intergenic
989011470 5:36876932-36876954 CGATGCCCCCCCGGTAGCTCGGG + Exonic
998141328 5:139701266-139701288 CTCTGCCCTCAGAGGAGCTAAGG + Intergenic
1003168392 6:3701124-3701146 CCCTGCCCCCAGGGGAGCACAGG + Intergenic
1003946145 6:11077852-11077874 GGCTGAACCCACAGGAGCTCTGG + Intergenic
1004424968 6:15501090-15501112 CCCTGTCCCCAGAGGAGCACCGG + Exonic
1005958192 6:30679199-30679221 CGCAGCCCGCCCTGGAGCTCTGG + Exonic
1006785258 6:36662383-36662405 CTATTCCCCCACAGCAGCTCAGG - Intergenic
1006829800 6:36961871-36961893 CGTTCCCCCTACAGGAGGTCAGG - Exonic
1007071526 6:39041674-39041696 CCCTGCCCCCAGATAAGCTCAGG + Intergenic
1007790463 6:44305577-44305599 AGCTCCTCCCCCAGGAGCTCAGG + Intronic
1013048549 6:106510813-106510835 CGCTCCTCCCATTGGAGCTCCGG + Intergenic
1018462017 6:164007435-164007457 CTCTGCCTCCACAGAAGCTCTGG - Intergenic
1019104157 6:169655330-169655352 AGCTGCCCGCACAGAAGATCAGG + Intronic
1019145173 6:169971415-169971437 CGCAGCCCCCACAGGAACCCGGG - Intergenic
1019286987 7:228573-228595 CGCTGCCCTCAGAGGAGAGCTGG - Exonic
1019361258 7:605239-605261 CGCTGACTCCGCAGGGGCTCGGG + Intronic
1019449298 7:1088494-1088516 CGCTGAGACCACCGGAGCTCCGG - Intronic
1019730015 7:2624400-2624422 CGCTGCTCTCACAGGACCACAGG - Intergenic
1024472114 7:49775253-49775275 CGCGGCCCCCACCCGGGCTCCGG - Intronic
1026398987 7:69989827-69989849 CGCTGATCTGACAGGAGCTCAGG - Intronic
1026838317 7:73652908-73652930 CCCTGCCCTCAGAGGACCTCTGG + Intergenic
1027184661 7:75963679-75963701 AGATGCCCCCACAGGAGCCTAGG + Intronic
1027234007 7:76287161-76287183 CCCTCCCCCCACTGGAGCCCGGG - Exonic
1029371699 7:100154780-100154802 AGCCCCCCCCACAGGAACTCGGG + Exonic
1030149822 7:106392695-106392717 CCCTTCCCCCACAGGTGCCCGGG + Intergenic
1031439995 7:121782361-121782383 GACTGGCTCCACAGGAGCTCCGG - Intergenic
1032858170 7:135854230-135854252 CCCTGGCCCTTCAGGAGCTCAGG - Intergenic
1033227740 7:139574627-139574649 CCCTGCACCCACAGAAACTCAGG + Intronic
1034493569 7:151407361-151407383 CTTTGCCCCCACGGCAGCTCTGG - Intronic
1035027582 7:155836036-155836058 CTCTGTCCCGCCAGGAGCTCTGG - Intergenic
1036754746 8:11464733-11464755 CGTTGGCCCTACAGGAGCCCCGG - Intronic
1042502835 8:69528113-69528135 CTTTGCCCCCACAGGACCTTTGG + Intronic
1043982402 8:86657613-86657635 CCCAGCTCCCACAGGAGCTCGGG - Intronic
1048799391 8:138182087-138182109 CGCTGCCACCACAGTGGCACCGG + Intronic
1049219076 8:141420655-141420677 CTCTGCCCCTCCAGGAGCTCAGG - Intronic
1049231800 8:141488501-141488523 TGTTGCCCCCACAGAAGGTCTGG + Intergenic
1049349644 8:142157677-142157699 CTCCACCCCCACAGGAGCACAGG + Intergenic
1049591323 8:143464328-143464350 CACTGCCCCCACAGGGTCTGGGG + Intronic
1049673468 8:143879646-143879668 CCCTGACCCCAGAGGAGCTCTGG + Intergenic
1052759247 9:32572938-32572960 TGCTGCCCCCACAGAAGATGGGG - Exonic
1060191763 9:121598456-121598478 CGCTGGCCCCACAGGTGCCGCGG + Intronic
1060344684 9:122805893-122805915 CGCTGAGCTGACAGGAGCTCAGG - Intronic
1060964606 9:127705677-127705699 AGCTGCTCCCACAGGAGCCTAGG - Intronic
1061020507 9:128011299-128011321 GGCTGCAGCCACAGGAGCCCTGG - Intergenic
1062016689 9:134294641-134294663 CGCGGCACCCCCAGGAGGTCGGG - Intergenic
1062351842 9:136143314-136143336 CCCTGCCACCCCAGGACCTCTGG - Intergenic
1062376233 9:136263088-136263110 CGCTGCCCCCACCTGAAGTCTGG + Intergenic
1062412859 9:136433584-136433606 TGCCGCCCACACAGGTGCTCTGG - Intronic
1062606741 9:137351919-137351941 GGCTGCCCTCACAGCAGCCCTGG + Intronic
1062715486 9:138008108-138008130 CACTGCCCCCTCAGGCTCTCTGG - Intronic
1187520781 X:20012041-20012063 AGCTGACCCCATGGGAGCTCTGG - Intronic
1192494497 X:71606000-71606022 TTCTGCACCCACAGCAGCTCTGG + Intronic
1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG + Intergenic
1202503493 Y:25496012-25496034 CCCTGATCCCACAGGAGCTTGGG - Intergenic