ID: 968679277

View in Genome Browser
Species Human (GRCh38)
Location 4:1905545-1905567
Sequence GCCACCTGCATGGCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968679274_968679277 6 Left 968679274 4:1905516-1905538 CCCTTGCTATGAGCTTATGTCTT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 968679277 4:1905545-1905567 GCCACCTGCATGGCCAAAACAGG 0: 1
1: 0
2: 1
3: 8
4: 135
968679273_968679277 27 Left 968679273 4:1905495-1905517 CCTGTGGGGGCAGCGTTGCTGCC 0: 1
1: 0
2: 2
3: 10
4: 140
Right 968679277 4:1905545-1905567 GCCACCTGCATGGCCAAAACAGG 0: 1
1: 0
2: 1
3: 8
4: 135
968679275_968679277 5 Left 968679275 4:1905517-1905539 CCTTGCTATGAGCTTATGTCTTT 0: 1
1: 0
2: 0
3: 18
4: 166
Right 968679277 4:1905545-1905567 GCCACCTGCATGGCCAAAACAGG 0: 1
1: 0
2: 1
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968679277 Original CRISPR GCCACCTGCATGGCCAAAAC AGG Intronic
900539552 1:3196044-3196066 GGCCCCTGCATGGACAAACCTGG - Intronic
902255716 1:15187423-15187445 GCCTCCTGCATGCCCAAGATGGG - Intronic
908127728 1:61047904-61047926 GAGACCTGTCTGGCCAAAACAGG - Intronic
910826686 1:91416717-91416739 GCCATCTGCATGGTTAAAAGTGG - Intergenic
915075559 1:153305923-153305945 GTCAGCTGCATTGCAAAAACTGG + Intronic
915465903 1:156097777-156097799 GCCAACTGCATGGCCTAATGTGG + Intronic
916701887 1:167305144-167305166 ACCACCTGGCTGGCCAAAAGAGG + Intronic
920262381 1:204698060-204698082 GCCAACTGCAGGGCCAAGCCTGG - Intergenic
923167434 1:231379530-231379552 GCCACCTGCAACCCTAAAACTGG - Intronic
1062819348 10:522575-522597 CCCAGCAGCCTGGCCAAAACTGG - Intronic
1063215913 10:3925349-3925371 GCCATCTGCATGTACAACACAGG - Intergenic
1065550498 10:26864342-26864364 GACACCAGCCTGGCCAACACGGG + Intergenic
1066693902 10:38061153-38061175 GCCATCTGCATGCCCAAGCCAGG - Intronic
1069809179 10:71145796-71145818 CCCAGCTGCAGGGCCACAACTGG + Intergenic
1070645711 10:78200839-78200861 GCCACCTGCCTGGCCCCAGCAGG + Intergenic
1074418433 10:113287308-113287330 GGGGCCTGCATGGCCCAAACAGG - Intergenic
1078024495 11:7681762-7681784 TCCACCTGCATGGACAAGCCTGG + Intergenic
1080959786 11:37145366-37145388 GCCCCATGCAAGGCCAAAATCGG + Intergenic
1081277517 11:41168111-41168133 CCCACCTGCAGGGACAAAGCAGG + Intronic
1083010187 11:59389358-59389380 GCAGCCTGCATGGCCAGGACTGG - Intergenic
1083196521 11:61091794-61091816 GCCACATGCATGTCCAGACCTGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1086833415 11:91593682-91593704 GCAGCCTGCATGGCCAGGACAGG - Intergenic
1098013170 12:66076028-66076050 GCCACTTGCAGGACCAAAGCAGG + Intergenic
1099666550 12:85637684-85637706 ACCACCTGCGTGGTCAAAAATGG + Intergenic
1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG + Intronic
1102325811 12:111982692-111982714 GCCACATGCATGTCCAGAGCAGG + Intronic
1104441681 12:128798333-128798355 GCCACCTCCATGGCCAGCTCAGG - Intronic
1105316184 13:19266188-19266210 GCCACCAGCCAGGACAAAACTGG - Intergenic
1106396375 13:29384877-29384899 GCCACCAGCATGGCTTGAACAGG - Intronic
1107123987 13:36824793-36824815 GCCAACTGTATGAACAAAACAGG - Intronic
1107318148 13:39156631-39156653 GCCATCTGCATGGCCAAGTCTGG + Intergenic
1107877536 13:44803971-44803993 GCCACCCACCTGGCCAAATCTGG - Intergenic
1110371583 13:74747035-74747057 GCAGCCTGCATTGCCAAAATTGG + Intergenic
1110497337 13:76184179-76184201 TCCACCAGCATGGGAAAAACTGG - Intergenic
1113078085 13:106488175-106488197 GCCATCTGCTTTGCCAAAAAGGG + Intergenic
1113835890 13:113328255-113328277 GGCACCTGCCTGGCCAGGACGGG + Intronic
1114051598 14:18923205-18923227 GTCACCTGCATGAGCAAACCTGG + Intergenic
1114110962 14:19478720-19478742 GTCACCTGCATGAGCAAACCTGG - Intergenic
1116210037 14:41926363-41926385 GACAACTACATGGTCAAAACAGG + Intergenic
1116957261 14:50937149-50937171 GGCACCTTCATACCCAAAACAGG - Intronic
1119177604 14:72580757-72580779 GCTTCCTACATGGCCAAGACAGG + Intergenic
1122882195 14:104695176-104695198 GCCACCTGCAGGGCCTGATCAGG + Intronic
1124866476 15:33497031-33497053 ACTACCTGCATGGCTAATACGGG + Intronic
1128613013 15:69088763-69088785 GTCACCTGCAGAGCCACAACAGG + Intergenic
1132955110 16:2587707-2587729 GGCACCAGCCTGGCCAACACAGG - Intronic
1134062207 16:11206045-11206067 GCCACCTGTCTGGCCACCACCGG + Intergenic
1136545622 16:30953167-30953189 GCCACCTGCAGGGACAAGAGGGG - Exonic
1137675713 16:50302863-50302885 TCCACCTCCATGTCAAAAACAGG - Intronic
1140383099 16:74508478-74508500 TCCAGCTGCATAGCCAAAACAGG + Intronic
1203138919 16_KI270728v1_random:1747443-1747465 GCCACCTGGCTGGCCAAGCCAGG + Intergenic
1145267616 17:21388007-21388029 GCCATCTTCACGGCCAGAACTGG - Intronic
1147946562 17:44083682-44083704 GCCCCCTGCAGGGCAAGAACAGG + Intronic
1148940012 17:51200273-51200295 GCCACCTGCCTGGCTAACATTGG - Intronic
1150248741 17:63694468-63694490 GACAACTGCATTGACAAAACTGG - Exonic
1151293892 17:73169608-73169630 GCCACCTGCATAGCCAAGAAAGG - Exonic
1156069540 18:33189599-33189621 GCCAATTGCTTAGCCAAAACAGG - Intronic
1157680935 18:49605520-49605542 GCCACCTGCATGTCCAGGACAGG + Intergenic
1157953322 18:52064779-52064801 GCCACCTCCCTGGCCAGAAGTGG - Intergenic
1161725418 19:5925585-5925607 GCCACCTGCATCGCCATGCCAGG + Intronic
1162843029 19:13370298-13370320 GAGACCTGCCTGGCCAAAATGGG - Intronic
1163682230 19:18689720-18689742 GCCAGATGAATGGACAAAACGGG - Intronic
1165130613 19:33629619-33629641 GCCAGCAGCATGGGCACAACGGG - Intronic
1166830010 19:45633537-45633559 GACACCTGCCTGGCCAACATGGG + Intronic
1167929314 19:52851162-52851184 GCTACCTGAAAGGCTAAAACAGG + Intronic
926608078 2:14917606-14917628 GCCACATGGAGGGTCAAAACTGG + Intergenic
927844395 2:26463939-26463961 GACACTTGCATGGCCAAGACTGG - Intronic
935185197 2:100725418-100725440 GCCACCTGCAGCGCCACAGCTGG - Intergenic
936112000 2:109672406-109672428 GCCATCTGCATGAGCAAATCTGG + Intergenic
937111171 2:119367815-119367837 GCCAACTGCCTGGCCACCACCGG - Intronic
941540648 2:166779755-166779777 GCTACCAACATGGCCACAACTGG - Intergenic
942064068 2:172253689-172253711 GCCACTCACATCGCCAAAACAGG - Intergenic
942936300 2:181560992-181561014 GTGACCTTCATGGCCAAAAGGGG - Intronic
946107211 2:217381550-217381572 TCCACCTGCATGGCCTTGACTGG + Intronic
946255792 2:218440924-218440946 GTCACCTGCAGGGCCAAATCTGG - Intronic
947932637 2:233976348-233976370 TCCTCCTGCATGACCCAAACAGG - Intronic
1171310184 20:24139330-24139352 GCCACCTCCAGGTCCAAACCAGG - Intergenic
1171533506 20:25867203-25867225 GCCACCTCCATGGGCATAAGGGG + Intronic
1173945106 20:46944196-46944218 AGGACCTGCTTGGCCAAAACAGG - Intronic
1175252644 20:57618778-57618800 GACACCAGCCTGGCCAAAAAGGG - Intronic
1176050825 20:63118828-63118850 CCCACCAGAATGGCCCAAACCGG - Intergenic
1177250498 21:18584976-18584998 GCTACCTGCATACCCAAACCTGG - Intergenic
1177323285 21:19549868-19549890 GGCACCTGGATTGCCAAAATTGG + Intergenic
1179644970 21:42770227-42770249 ACCCCCAGCATGTCCAAAACAGG + Intronic
1180470072 22:15645580-15645602 GTCACCTGCATGAGCAAACCTGG + Intergenic
1180876482 22:19177454-19177476 GACACCTTCACTGCCAAAACTGG - Intronic
1182028552 22:27139147-27139169 GCCAGCAGCATCCCCAAAACAGG + Intergenic
1184168523 22:42744664-42744686 GCCAGCAGCATGGCCGAAGCAGG + Intergenic
1184869850 22:47230269-47230291 GCCACATGCTTGTCCAAAAGAGG - Intergenic
952920317 3:38279423-38279445 GAGACCTGAATGGCCAAGACTGG + Intergenic
953049193 3:39325095-39325117 AGCACCTGCATTGCCAAAAGTGG - Intergenic
960109603 3:113832947-113832969 GCCACATCCATGCCCAAAGCTGG - Intronic
961264895 3:125633984-125634006 GCCAAGTGCCTGGCCAAAGCAGG + Intergenic
962863203 3:139423634-139423656 GCCACCTGCATGGCGTCAGCAGG + Intergenic
964959283 3:162404044-162404066 GCCACCTGCCTGGCCCAGATTGG + Intergenic
965042187 3:163523164-163523186 GCCACTTGCATGGACAAATTGGG + Intergenic
968285226 3:197504719-197504741 GCCAGCTGCATGGCCAGAGGAGG + Intergenic
968679277 4:1905545-1905567 GCCACCTGCATGGCCAAAACAGG + Intronic
969231549 4:5835273-5835295 CCCTCCTGCATGGCCAAGAGTGG - Intronic
970274275 4:14380954-14380976 GAGACCAGCCTGGCCAAAACAGG + Intergenic
974703476 4:65482096-65482118 GAGACCAGCATGGCCAACACGGG + Intronic
979460812 4:120980916-120980938 GCAACCTGATTGGCCCAAACTGG - Intergenic
982399370 4:154949552-154949574 CCCACCTTCAAGCCCAAAACAGG + Intergenic
984513569 4:180710122-180710144 GACACCAGCCTGGCCAACACGGG + Intergenic
985619943 5:948934-948956 GCCACCTGCACCCCCAGAACAGG + Intergenic
985850546 5:2385473-2385495 GTCACCTGCATGTGCAAAATGGG + Intergenic
989199548 5:38750148-38750170 GCCACCTACATGGCAAACCCTGG + Intergenic
1001685184 5:173589156-173589178 GAGACCAGCTTGGCCAAAACTGG + Intergenic
1002212883 5:177608953-177608975 GCCACCTGCATGACCCAGCCTGG + Exonic
1004591985 6:17060628-17060650 GCCACCAGCATAGCCCATACAGG + Intergenic
1005821673 6:29604266-29604288 TCCACCTGCCAGGCCAACACTGG + Intronic
1009548687 6:65057649-65057671 GCCACCTGCATTGACCAACCTGG - Exonic
1009893743 6:69721386-69721408 GATACCAGCATGGCCACAACAGG + Intronic
1024063731 7:45716629-45716651 ACCACCTGGATGGCCGAAGCTGG - Exonic
1024582296 7:50809866-50809888 GACACCTGCAGGGCCAGACCAGG + Intergenic
1024995726 7:55271975-55271997 GCCTCCTGCATAAACAAAACAGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1028458930 7:91069994-91070016 GCAACCAGCTTGGCCAACACAGG - Intronic
1028973216 7:96882723-96882745 GACACCAGCATGGCCAATATAGG + Intergenic
1029476226 7:100786348-100786370 TCCACCTGCAGGGCAAAAAGAGG + Intronic
1035228024 7:157444265-157444287 GCCATCTGCAGAGCCAAGACAGG + Intergenic
1037336015 8:17792662-17792684 GCCACCAGCCTGGCCAACATGGG + Intronic
1037436163 8:18865766-18865788 GTCACCTGCATTGTCAAACCAGG - Intronic
1039752633 8:40492341-40492363 CCCACCTGCTTGGCCAACACTGG - Intergenic
1042803116 8:72742571-72742593 GCCACCTGGATGCCCATAGCTGG - Intronic
1044641693 8:94389239-94389261 GCCACCGCCCTGGCCAAGACGGG + Intronic
1047347016 8:124038484-124038506 GCAACCTGCATGTCCATCACTGG - Intronic
1049495046 8:142926106-142926128 GCCACCTGCATGGCCCAGTGGGG - Intergenic
1050215672 9:3320351-3320373 GAGACCAGCCTGGCCAAAACAGG + Intronic
1053300650 9:36946904-36946926 GCCACGTGCAGGGCCAAAACAGG + Intronic
1062280392 9:135749254-135749276 GCCACCTGCATGACCCAGGCTGG - Intronic
1187930323 X:24287709-24287731 GAGACCAGCATGGCCAACACAGG - Intergenic
1188206686 X:27368123-27368145 GACACCAGCCTGGCCAAAATGGG - Intergenic
1189456961 X:41200338-41200360 CCAAACTGCATGGCCAAAAATGG - Intronic
1190039036 X:47054270-47054292 GCCTCAAGCATAGCCAAAACAGG + Exonic
1191626339 X:63275174-63275196 GCTACCTGCCTGCCCAAACCAGG + Intergenic
1191959359 X:66683121-66683143 GCCACCTGCATGGCAAAATTAGG - Intergenic
1193570666 X:83137862-83137884 GAGACCTGCATGGCCAACATGGG + Intergenic
1193670298 X:84376390-84376412 GGTACCAGCATGGCCACAACTGG + Intronic
1194341308 X:92709612-92709634 GCCACTTTCATTGCTAAAACTGG - Intergenic
1196138486 X:112235026-112235048 GCCACCTGGATCCCGAAAACAGG - Intergenic
1196354777 X:114777755-114777777 GACACCAGCCTGGCCAACACAGG - Intronic
1197711767 X:129676687-129676709 GCCACATGAAGGGCCAAAGCAGG - Intergenic
1199738773 X:150711702-150711724 ACCAGCTGCATGGCCAAAGGGGG - Intronic
1200649660 Y:5826325-5826347 GCCACTTTCATTGCTAAAACTGG - Intergenic