ID: 968679605

View in Genome Browser
Species Human (GRCh38)
Location 4:1908045-1908067
Sequence CTGTGCTAAGAGCAGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968679602_968679605 18 Left 968679602 4:1908004-1908026 CCGCATTTCGGGAAACATCACAT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170
968679601_968679605 22 Left 968679601 4:1908000-1908022 CCAGCCGCATTTCGGGAAACATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968679605 Original CRISPR CTGTGCTAAGAGCAGGTGTA GGG Intronic
906733300 1:48101570-48101592 CTGTGCTCACAACAGGTGCACGG - Intergenic
911840877 1:102680263-102680285 CAGTGCTAAGGGCAGATGCATGG + Intergenic
916391604 1:164336987-164337009 TTGTGATAATAGCAGGTGAATGG - Intergenic
919086706 1:192929170-192929192 CTGAGCTCAGAGAAGGTCTAAGG - Intergenic
919087437 1:192937314-192937336 GTCTTCTAAGAGCTGGTGTAGGG + Intergenic
919422692 1:197390321-197390343 CTGTGCTCAGAGGAGGTAAATGG + Intronic
919685973 1:200483968-200483990 CAGTGCTAAGGGCAGGTTGATGG - Intergenic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
920672520 1:208015379-208015401 CTGTTCCAAGAGCAGCTGAAAGG - Intergenic
920693796 1:208166278-208166300 CTGTCCTAAGAGCAGATGTTAGG + Intronic
920848282 1:209611531-209611553 CTTTGCTAAGAGCAAGTGGAGGG + Exonic
923026453 1:230208398-230208420 CTGTGAGTGGAGCAGGTGTAGGG + Intronic
923056360 1:230428437-230428459 CTGTGGTAAGAGAAGGAGTGAGG + Intergenic
924427765 1:243969088-243969110 CTGTTCTAAGAGGAGCTGTTAGG + Intergenic
1062763577 10:45508-45530 CTGTTCTAAGAGCAGGAAAAGGG - Intergenic
1063118237 10:3086047-3086069 CTGTACTAAGAGCAGCTCTCAGG - Intronic
1065616884 10:27536175-27536197 TTGAGATAAGAGCAGGTTTAGGG + Intronic
1068917237 10:62445480-62445502 CAGTTCTAAGAGCAGGGGTGAGG + Intronic
1070440644 10:76439765-76439787 CTGTGCTAAATGCAGGCGTATGG + Intronic
1072301795 10:94068957-94068979 CTGTGCTAAGCACAGGGGCAGGG - Intronic
1075174730 10:120148898-120148920 CACTGCTAAGAGTTGGTGTATGG + Intergenic
1075598476 10:123749512-123749534 CTGCGATAACAGCAGGTTTAGGG - Intronic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076348275 10:129795619-129795641 TTGTAATAAGAGCAGTTGTACGG - Intergenic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1077481200 11:2815490-2815512 CTGAGCTGAGATCAGGTGTTTGG - Intronic
1078879996 11:15438587-15438609 CTGTCCTATGAGCAGGGGTTGGG - Intergenic
1086947571 11:92858329-92858351 CTGTGCACATAGCAGGTGGATGG + Intronic
1090081546 11:123616785-123616807 CTGTGCTAAGTGAAGGTCAAGGG - Intronic
1090223110 11:125048266-125048288 CTGTGCTAAGAGCAGTTTATAGG - Intergenic
1090865575 11:130697914-130697936 CTGTGCTGAGAGCTGCTCTAAGG - Intronic
1091079938 11:132657131-132657153 GTCTGCACAGAGCAGGTGTACGG + Exonic
1095374038 12:41505070-41505092 GTGTGCTCAGAGCAAGTGTGGGG - Intronic
1095473220 12:42558833-42558855 CTGTTCAAAGAGCAAGTATATGG + Intronic
1096099580 12:48961523-48961545 ATGTGCTAGGAGCAGGGATAGGG + Intergenic
1096965137 12:55620240-55620262 ATGTGGAAAGAGCAGATGTATGG - Intergenic
1098356431 12:69616904-69616926 AGGTGCCAAGAGCAGGTCTAAGG + Intergenic
1103585720 12:121953916-121953938 GTTTGCTAAGAGCAAGTGAAGGG - Intronic
1104346047 12:127999865-127999887 CTGTGTTAACAGCAGTTATAAGG - Intergenic
1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG + Intergenic
1112474843 13:99722031-99722053 CTGTGCTAAGAGCAAATGCAGGG - Intronic
1113931917 13:113973093-113973115 CTGAGCTAAGGGGAGGAGTAAGG + Intergenic
1114747452 14:25165096-25165118 CTGGCATAAAAGCAGGTGTATGG - Intergenic
1115732528 14:36286795-36286817 CGGTGGGAAGAGCAGGTGGATGG - Intergenic
1116924519 14:50620437-50620459 CTGTGAGAAGAGCAGGTTTCAGG + Intronic
1117200900 14:53388963-53388985 CTCTGCTAGGATCATGTGTAAGG - Intergenic
1119143528 14:72289506-72289528 TTTTGCTAAGAGCAGGGGTGGGG - Intronic
1120309026 14:82806754-82806776 CTGCTCTAAGAGGAGGTTTAGGG + Intergenic
1121321451 14:92994017-92994039 CTCTGGTTAGAGCAGGGGTAGGG + Intronic
1121876807 14:97460197-97460219 CTGTGCTCTGAGCAGGTGTTTGG + Intergenic
1121951886 14:98178012-98178034 CTGTGCGAAGATCAGGAGAATGG + Intergenic
1122218662 14:100221324-100221346 CTGTCCTAAGGGCAGATTTATGG - Intergenic
1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG + Intergenic
1125149624 15:36517100-36517122 CAGTCCTAAGAGCGGGTGCATGG - Intergenic
1127709177 15:61578636-61578658 CTGGGGTATGACCAGGTGTAGGG + Intergenic
1127739348 15:61885027-61885049 CTGACCTCAGTGCAGGTGTAAGG - Intronic
1128801363 15:70499159-70499181 CTGAGCCCAGTGCAGGTGTATGG - Intergenic
1130942224 15:88520541-88520563 CTGTGGGTAGAGCAGGTTTAGGG - Intronic
1132852909 16:2032903-2032925 GGGGGCTAAGAGCAGGTGTGAGG + Intronic
1134040855 16:11067334-11067356 CTGTTCTAAGAGCAGGTGACGGG + Intronic
1135160939 16:20095849-20095871 CTGTCCTAAGCACAGGTGTGGGG + Intergenic
1135617988 16:23928582-23928604 CTGAGCTAGGAGCTGGGGTAAGG + Intronic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1137724696 16:50649393-50649415 CTGAGCTAGGAGCAGGTTTTGGG - Intergenic
1138778119 16:59749837-59749859 CTGTGGGAAGAGCAGCTGCAGGG + Intronic
1141848036 16:86624242-86624264 CTGTACAGAGAGCAGGTGCAAGG - Intergenic
1142279791 16:89141830-89141852 CAGTGCTCAGAGCACGTGTGTGG - Intronic
1146484076 17:33229338-33229360 CTGTGCTGAGAGCTGGGGAAGGG + Intronic
1147378232 17:40035704-40035726 CTGAGGTAAGGGCAGGGGTAAGG - Exonic
1152232327 17:79120222-79120244 CTGTGCTGAGTGCAGGGATATGG - Intronic
1152956486 18:45839-45861 CTGTTCTAAGAGCAGGAAAAGGG - Intergenic
1152962661 18:89094-89116 ATGTGCTAAGAAGAGGTGTCAGG - Intergenic
1153618352 18:6954078-6954100 CTGAGCTAAGAGCAGCTATGAGG + Intronic
1154009839 18:10565030-10565052 TGGGGCTAAAAGCAGGTGTAGGG - Intergenic
1158552641 18:58449610-58449632 CTGTGTTAGGAGGAGCTGTAGGG + Intergenic
1158730782 18:60020223-60020245 CTGTGCTAACAGCAGCAGTTAGG - Intergenic
1162500246 19:11049259-11049281 CTTGGCTAAGGGCAGGTGTGTGG - Intronic
1163772050 19:19197192-19197214 CTGTGCTGCGAGCTGGTGGATGG - Exonic
1163860958 19:19742613-19742635 CTGGGCTAAGACCAGGGGTGGGG + Intergenic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1167120396 19:47513226-47513248 GTGTGCTAAGAGGAGCTGAAAGG - Intronic
1167490439 19:49789928-49789950 CTGTGCTAGGAGCTGGGTTATGG + Intronic
1167998910 19:53429248-53429270 CTGTGCTGAGAGCAGATATTTGG + Intronic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
927127208 2:20022770-20022792 CTGCAGTAAGAGCAGGTGCAAGG + Intergenic
927485281 2:23484615-23484637 CTGTGCTAATGGCAGGGGTGTGG - Intronic
933274244 2:80266808-80266830 CTGTGCTGGGTGCATGTGTAAGG - Intronic
935170518 2:100608174-100608196 GTGGGCTAAGAGCAGGTTTGAGG + Intergenic
936149776 2:110009318-110009340 CTGCACTCAGGGCAGGTGTAAGG - Intergenic
938822762 2:134975866-134975888 CTGTCCTCAGAGCATGTGTGTGG + Intronic
940238457 2:151536494-151536516 ATCTTCTAAGAGCAGGTGTGGGG + Intronic
941001692 2:160209006-160209028 CTGTGGGAAGAGCAAGTGCAAGG + Intronic
944399690 2:199311227-199311249 CTGAGCTAATAGCATGTTTAAGG + Intronic
948172387 2:235915107-235915129 GTGGGCTCTGAGCAGGTGTATGG - Intronic
948554653 2:238799831-238799853 CTGTGCTGTGTGCAGGTGTGAGG + Intergenic
1172698937 20:36840897-36840919 CTGTGCTAAGCGCAGGGGCAGGG + Intronic
1172801650 20:37580401-37580423 CTCTGCTGAGAGCAGGAGTGAGG - Intergenic
1173553610 20:43950142-43950164 CTCTGCTCAGAGCAGATGTGAGG - Intronic
1174062049 20:47839737-47839759 GAGTGCTCAGAGCAGGTGAATGG + Intergenic
1175783396 20:61697626-61697648 CTGTGATGAGAGCAGGGTTAGGG - Intronic
1177284198 21:19026625-19026647 ATGTGCAAATAGCAGGTGTTCGG + Intergenic
1178630470 21:34255488-34255510 CTGTGCTGAGAGATGGTGTTGGG + Intergenic
1180582977 22:16859055-16859077 CTGCACTCAGGGCAGGTGTAGGG + Intergenic
1182299334 22:29329102-29329124 CTGGGCTGACAGCAGGTGTGTGG - Intronic
1182710329 22:32318678-32318700 CTGTGTTGAGAGCAGATGGAAGG - Intergenic
1182848173 22:33448640-33448662 CTGAGGGAAGAGCAGGTGTGAGG - Intronic
1183422377 22:37719366-37719388 CTTTGCTGAGAGCAGGTGGCTGG + Intronic
1184224795 22:43123351-43123373 CTGTGCTGACAGCAGGTGCCTGG + Intronic
1184397899 22:44255643-44255665 CTGTGTTGAGAGCAGATGGAAGG - Intronic
1184670686 22:46011070-46011092 GAGTGCTGAGAGCAGGTGGAGGG + Intergenic
1185132367 22:49046493-49046515 CAGAGCTATGAGCAGGTGTGTGG + Intergenic
950016685 3:9759487-9759509 CTTTGCCAAGAGCAAGTGGAAGG - Exonic
950620610 3:14202522-14202544 CTGTCCTAAGGTCAGTTGTAAGG + Intergenic
950748365 3:15108580-15108602 CTGTGGGAAGAGCAGGTTTAGGG - Intergenic
954439374 3:50513312-50513334 CTGTGCCAAGAACAGGCTTAGGG - Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956100113 3:65759378-65759400 TTGTGCTAAGCACAGATGTAAGG - Intronic
956345919 3:68278670-68278692 CTGTGCTAAGAAAAGGTGCAAGG - Intronic
961721712 3:128901419-128901441 CTCTGCTACGAGCAGGGATAGGG - Intronic
963847766 3:150177432-150177454 CTTTGCTAAGAGGAGGTGTATGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968357845 3:198122391-198122413 CTGTTCTAAGAGCAGGAAAAGGG + Intergenic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
969995978 4:11313687-11313709 CTGTTCTAGGAGCAGGAGTGCGG + Intergenic
970311149 4:14783844-14783866 CTGTGGAAAGAGCAGTGGTATGG - Intergenic
970319839 4:14864181-14864203 CTGCCCTAAAAGGAGGTGTAAGG - Intergenic
971075596 4:23145262-23145284 CAGTGATAATAGGAGGTGTAGGG + Intergenic
972389364 4:38600010-38600032 CTGTGCTAAAAGAAACTGTATGG + Intergenic
975196232 4:71527462-71527484 CTATTCAAAGAGCAGGTTTAGGG + Intronic
975671891 4:76788162-76788184 AGGTGCTCAGAGCAGCTGTAGGG - Intergenic
984257060 4:177401725-177401747 CTGTGCTAACAGCAGTTGTTAGG - Intergenic
984501469 4:180564598-180564620 CTGTGCGAGAAGCAGATGTAAGG - Intergenic
986134246 5:4959402-4959424 CTGTGCAATAAGCAGGAGTAAGG - Intergenic
988656331 5:33215900-33215922 ATGTGCTGAGAGCAGGAGCAAGG + Intergenic
990269387 5:54119118-54119140 CTGTGCAAAGAGCCGTTGGAAGG - Intronic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
991244933 5:64500398-64500420 GTTGGCTAAGAGCAGGAGTAAGG - Intergenic
993432545 5:87849589-87849611 TTTTGCTGAGAGCAGGTGTTTGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000812013 5:165874757-165874779 CTGTGGGAGGAACAGGTGTAAGG + Intergenic
1002000403 5:176193698-176193720 CTGTGCTGACAGCGGGTGCAGGG - Intergenic
1002394566 5:178942673-178942695 CTCTCCTAATAGCAGGTGTGTGG + Exonic
1002478282 5:179482543-179482565 CCTTGCTAAGAGCAGGTCAAGGG - Intergenic
1003447469 6:6197856-6197878 CTCTGCTAAGAGCAGCTTCAAGG + Intronic
1003465759 6:6378382-6378404 TCTTCCTAAGAGCAGGTGTATGG + Intergenic
1004077942 6:12362438-12362460 CTGTGCTGAGACCATGTGGAAGG + Intergenic
1006349265 6:33509148-33509170 CTGTGGGAGGAGCAGGTTTATGG - Intergenic
1007545535 6:42690842-42690864 CTTTGCCAAGAGCAGGTAAAAGG - Intronic
1009941030 6:70288145-70288167 CTGTGGGAAGAGCAGGTGTCAGG - Intronic
1012543728 6:100393469-100393491 CCATGGTAAGAGCAGGTGAAAGG - Exonic
1013291982 6:108727920-108727942 CTGTGCTTAGAGAAGGAGTGTGG + Intergenic
1016245926 6:141980768-141980790 CTGTGGTAGGAGTATGTGTAAGG - Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1019665276 7:2249145-2249167 CTGTGCCTGGAGGAGGTGTAAGG - Intronic
1022242576 7:28527298-28527320 CTGAGATAAAAGCAGTTGTATGG - Intronic
1024549977 7:50554693-50554715 CTCTGAGAAGAGCAGTTGTATGG - Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1029282630 7:99446226-99446248 CTGTGCTAACAGAAGGTGGCTGG - Intronic
1030009889 7:105155446-105155468 CTGGGATAAGAGAAAGTGTAAGG - Intronic
1030679162 7:112416018-112416040 TTGTGCAGAGAGAAGGTGTATGG + Intergenic
1032883636 7:136115668-136115690 CTCTGCTGAGAGCAGCTGGAGGG + Intergenic
1034235734 7:149567621-149567643 CTGTGACAAGAGCAGAAGTAGGG + Intergenic
1035262535 7:157671122-157671144 ATGTGGTAAGAGCAGGTCTGTGG - Intronic
1039761889 8:40585498-40585520 CTTTGTAAAGTGCAGGTGTATGG - Intronic
1039969005 8:42305890-42305912 AGGTGCTAAGGGCAGCTGTATGG - Intronic
1045752227 8:105498597-105498619 CTGTGCTAAGAGCAGATGCTTGG - Intronic
1047181553 8:122593584-122593606 CTGTGCTGGGAGAAGGTTTATGG - Intergenic
1047345353 8:124022637-124022659 CTTGCCTAAGAGCAAGTGTAAGG + Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1052032438 9:23644004-23644026 CTGTATTAAGAGCAGAAGTAAGG - Intergenic
1058375718 9:104319078-104319100 TTGTGTTAAGAGAAGGTTTAGGG + Intergenic
1060783659 9:126432299-126432321 AAGTGCTAAGAGCAGGTGAAGGG - Intronic
1060966432 9:127714690-127714712 CTGTGCTAAGCGGAGCTGTTTGG - Exonic
1061789539 9:133051832-133051854 CTGTGCCAAGTGCAGTTGTGGGG - Intronic
1061884017 9:133582581-133582603 CTGTGCTGATAGCAGGTTTGGGG + Intronic
1062614254 9:137388887-137388909 CTGTGCTGATAGCAGGTGCCTGG - Intronic
1062735479 9:138135022-138135044 ATGTGCTAAGAAGAGGTGTCAGG + Intergenic
1185831636 X:3308809-3308831 CTGTGCTCAGAGGAGGTGAGAGG - Exonic
1187471012 X:19569785-19569807 CTGGGCTAGGAGCAGCTCTATGG + Intronic
1189401361 X:40671900-40671922 CTGTGCTATGATAAGATGTAGGG + Exonic
1189609144 X:42713622-42713644 CTGTGGTAAGAGTAGGTTCAGGG + Intergenic
1192978232 X:76309620-76309642 CGGGGCTGAGGGCAGGTGTAAGG - Intergenic
1196776876 X:119346250-119346272 CTGTGCTAACTGCTGCTGTAAGG + Intergenic
1199973630 X:152878346-152878368 CTGTGCTGAGAACAGGAGTGAGG + Intergenic