ID: 968681660

View in Genome Browser
Species Human (GRCh38)
Location 4:1925142-1925164
Sequence CTAGGTTACAGATGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968681660_968681666 7 Left 968681660 4:1925142-1925164 CCCTGCTTCCATCTGTAACCTAG 0: 1
1: 0
2: 4
3: 19
4: 191
Right 968681666 4:1925172-1925194 TACATTGTTTTTTATTTTTCGGG 0: 1
1: 1
2: 21
3: 436
4: 3343
968681660_968681669 30 Left 968681660 4:1925142-1925164 CCCTGCTTCCATCTGTAACCTAG 0: 1
1: 0
2: 4
3: 19
4: 191
Right 968681669 4:1925195-1925217 AGTGCTGGTGCACACAAGGATGG 0: 1
1: 1
2: 1
3: 11
4: 177
968681660_968681665 6 Left 968681660 4:1925142-1925164 CCCTGCTTCCATCTGTAACCTAG 0: 1
1: 0
2: 4
3: 19
4: 191
Right 968681665 4:1925171-1925193 CTACATTGTTTTTTATTTTTCGG 0: 1
1: 0
2: 17
3: 274
4: 2746
968681660_968681668 26 Left 968681660 4:1925142-1925164 CCCTGCTTCCATCTGTAACCTAG 0: 1
1: 0
2: 4
3: 19
4: 191
Right 968681668 4:1925191-1925213 CGGGAGTGCTGGTGCACACAAGG 0: 1
1: 0
2: 0
3: 23
4: 212
968681660_968681667 15 Left 968681660 4:1925142-1925164 CCCTGCTTCCATCTGTAACCTAG 0: 1
1: 0
2: 4
3: 19
4: 191
Right 968681667 4:1925180-1925202 TTTTTATTTTTCGGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968681660 Original CRISPR CTAGGTTACAGATGGAAGCA GGG (reversed) Intronic
901180808 1:7340593-7340615 ATAGGTGACGGATGGAAGCCAGG - Intronic
902433827 1:16384154-16384176 CTATGCTACTGATGGAAACAAGG + Intronic
905501939 1:38446327-38446349 CAAGGTAGCAGATGGAAGAAGGG - Intergenic
908668844 1:66523179-66523201 TAAGGTTACAGATGGAAATAAGG + Intergenic
912947753 1:114098804-114098826 CTTGGTGCCAGATGGAAGAATGG + Intronic
913235458 1:116777244-116777266 CTAGGTGTCAGATGGCAGGAAGG + Intergenic
913412253 1:118564845-118564867 CAAGGTTACAGAGGTAAGTAAGG - Intergenic
913412280 1:118565162-118565184 CAAGGTTACAGAGGTAAGTAAGG - Intergenic
915466660 1:156102336-156102358 CTGGGGTACAGAGGGCAGCAAGG + Intronic
916229193 1:162522540-162522562 TTAGGTTACTGATTAAAGCAAGG - Exonic
916744319 1:167672689-167672711 TAAGGTTACAGATGGAATTAAGG - Intronic
918792310 1:188844281-188844303 TTATTTTACAGATGGAAACAAGG + Intergenic
921071555 1:211662680-211662702 GTAGGGTACAGAAGGAAACATGG - Intronic
924826187 1:247541486-247541508 CTGGGGTGCAGATGGAACCAAGG + Intronic
1062949041 10:1482806-1482828 CTAGAACACAGATGGAAGAAGGG - Intronic
1064152881 10:12879785-12879807 CTAGGGAACAGGTGGAAACATGG - Intergenic
1064969922 10:21054622-21054644 CTTGGATACAGATGAAAGGAAGG + Intronic
1065264548 10:23961187-23961209 TTAGGTTACAGCTGGAGGAAAGG - Intronic
1065490811 10:26279860-26279882 TTAGGAAACAGATGGAAGCAGGG + Intronic
1065856391 10:29833920-29833942 TTAGGTTATACATGCAAGCAGGG + Intergenic
1067185157 10:44021079-44021101 CTGGCTTACAGATGGTAGCATGG + Intergenic
1069025618 10:63537733-63537755 CCAGGCCACAGATGGAGGCAGGG + Intronic
1071309002 10:84326041-84326063 TTAGGTTGCAGATGGAATTAAGG + Intergenic
1072418783 10:95271766-95271788 CTAGGTCACTCCTGGAAGCAAGG - Exonic
1072568129 10:96635123-96635145 TAAGATTACAGATGGAATCAAGG - Intronic
1073452427 10:103617747-103617769 CTGGGACACAGATGGAAACAGGG - Intronic
1077842725 11:5992759-5992781 CTGGGTAACAGATGGGACCAAGG - Intergenic
1078987330 11:16608300-16608322 TTAGGTGACAGAAGGAGGCATGG + Intronic
1079036651 11:17025986-17026008 CTAGGATACAGAGGGGAGCTGGG - Intergenic
1080075431 11:28141918-28141940 TTAGTTTACAGTTTGAAGCAAGG - Intronic
1081374125 11:42339261-42339283 CAAGGTTGCAGAGAGAAGCAAGG - Intergenic
1083857487 11:65400362-65400384 CCAGGACACAGATGGCAGCAGGG - Intronic
1086756457 11:90569614-90569636 CTAACTTAAAGATGGAAGAAAGG + Intergenic
1090161892 11:124504080-124504102 CTAGGGTACAAAAGGAAACATGG + Intergenic
1093099677 12:15012742-15012764 TGATGTTACAGATGGAAGGAAGG + Intergenic
1093328981 12:17812527-17812549 GGAAGTTACAGATAGAAGCATGG - Intergenic
1093431771 12:19092889-19092911 CTAGGATACAGATGGACTCACGG - Intergenic
1094709558 12:32947876-32947898 CTAGGTTACAGTGTGATGCATGG + Intergenic
1095858928 12:46892782-46892804 CCATGTTACAGATGGAAAAACGG - Intergenic
1099487734 12:83249238-83249260 CAAGGTTGCACAGGGAAGCAAGG - Intergenic
1100873743 12:98940406-98940428 CTAGGTTAGAGATAGAAGAAAGG - Intronic
1103343482 12:120233936-120233958 CCAGGGGACAGATGGAAGCCAGG + Intronic
1103473309 12:121199321-121199343 ATCTGTTACAGACGGAAGCAAGG - Intergenic
1103605893 12:122085900-122085922 TAAGGTTACAGATGGAATCAAGG + Intronic
1106315055 13:28586007-28586029 CTGGGATGCAGATGGAAACATGG + Intergenic
1109272689 13:60272105-60272127 AAAGGTTAGAGATTGAAGCAGGG - Intergenic
1111059288 13:82991464-82991486 CACGGTTTCAGATGGAAGCATGG - Intergenic
1113234180 13:108251434-108251456 CTAGGTCACATATGGAACCTGGG - Intronic
1115206188 14:30908069-30908091 CTAGCTTCCAGATACAAGCAAGG + Intronic
1116704316 14:48277352-48277374 TTAGGTTGCAGATGGAATTAAGG - Intergenic
1118479930 14:66154073-66154095 TGAAGTTACACATGGAAGCAAGG + Intergenic
1119845951 14:77830011-77830033 CTAGGTAACAGAGGGACTCAAGG + Intronic
1120463591 14:84827425-84827447 ATAGGCTGAAGATGGAAGCAAGG - Intergenic
1120758372 14:88265066-88265088 GCAGGATACACATGGAAGCAGGG - Intronic
1121223693 14:92305911-92305933 CTAGGTTTCATCTGGAATCATGG + Intergenic
1124052505 15:26210827-26210849 CTGGGTTTCAGTTGGAATCAAGG - Intergenic
1131940408 15:97558588-97558610 TCAGGTAGCAGATGGAAGCAAGG - Intergenic
1132659055 16:1053527-1053549 CTCGGCTACAGATGCCAGCAGGG + Intergenic
1134748378 16:16605615-16605637 CTAGGTGACAGAGGGACACAGGG - Intergenic
1134880800 16:17743898-17743920 GAAGGAAACAGATGGAAGCAGGG + Intergenic
1134997086 16:18748004-18748026 CTAGGTGACAGAGGGACACAGGG + Intergenic
1135272192 16:21078967-21078989 CCATGTTACAAATGGAACCAAGG + Intronic
1135487002 16:22874507-22874529 CCAGGACACACATGGAAGCATGG - Intronic
1135739768 16:24964756-24964778 CCAGGTCACAGATGGTAGTATGG - Intronic
1136012143 16:27370699-27370721 TAAGGTTACAGATGGAAGCAGGG + Intergenic
1137739469 16:50753503-50753525 CTATGGGACAGATGGAGGCAAGG - Intronic
1139270452 16:65677612-65677634 CTATGTGACAGATGAATGCATGG - Intergenic
1140739288 16:77926843-77926865 CTAGGTCACATGTGGAAGGAGGG - Intronic
1141235638 16:82213412-82213434 TTAGGTTGCAGATGGAATTAAGG + Intergenic
1141748172 16:85940100-85940122 TAAGGTTGCAGATGGAATCAAGG - Intergenic
1142057522 16:88007799-88007821 CTAGGATTCAGATGGCAGAATGG + Intronic
1143088958 17:4437177-4437199 GTAGGCTACAGATGAAAGCAAGG + Intronic
1144078874 17:11744264-11744286 CTAGGCTTCAGGTGGCAGCATGG - Intronic
1144236991 17:13271393-13271415 CTAGGGGACAGCTAGAAGCAGGG - Intergenic
1146667835 17:34716586-34716608 CCAAGTAACAGATGGAAGAAGGG - Intergenic
1153595543 18:6721449-6721471 GCAGGTAACAGATGGAAACAAGG - Intergenic
1162469679 19:10864948-10864970 CTGGGATACAGATGGTAGGAAGG + Intronic
1163067070 19:14805312-14805334 CTAGATTACAGAAGGCACCAGGG - Intronic
1165976210 19:39679039-39679061 CTTGGTCAGAGATGGATGCAAGG + Intergenic
1166232450 19:41433143-41433165 CTAGGTTTGTGATGGATGCAGGG + Intronic
1167799939 19:51733822-51733844 ACAGGTTACAGATGGATTCAGGG + Intergenic
926349008 2:11978326-11978348 GTAGGTTTCAGATGGAGGCACGG - Intergenic
926691506 2:15737523-15737545 CTAGGGTACAGAAATAAGCAAGG - Intronic
927947303 2:27143658-27143680 GGAACTTACAGATGGAAGCATGG - Intergenic
929526376 2:42706994-42707016 CTGGGTTACAGAGGGAAGCGGGG - Intronic
929753214 2:44739203-44739225 TTGGATGACAGATGGAAGCAGGG + Intronic
930661663 2:54060859-54060881 CTAGGATACAAATGAAAGAATGG - Intronic
933395968 2:81731627-81731649 CCATATTACAGATGGAAGAATGG - Intergenic
933459727 2:82566863-82566885 CTTGGTTACAGATAGCTGCAAGG + Intergenic
936721541 2:115257044-115257066 CAAGGTCTCAGATGGAAGTAAGG - Intronic
936947688 2:117945354-117945376 CTAGGCCTCAGATGGAGGCAGGG - Intronic
937196830 2:120164858-120164880 CTCAGTTAGAGATGCAAGCAAGG - Exonic
939877472 2:147594199-147594221 TAAGGTTGCAGATGGAATCAAGG - Intergenic
940733138 2:157417814-157417836 CTAGGTTACAGACTTAAGCTTGG + Intronic
941551943 2:166927695-166927717 CAAGGTTGCAGATGGAATTAAGG - Intronic
944661086 2:201922441-201922463 CTTGGTTACAGATGGAGGAGTGG + Intergenic
945230972 2:207589473-207589495 TTAGGTTGCAGATGGAATTAAGG - Intronic
1168772090 20:421843-421865 CTAGGGGCCAGATGGATGCAGGG + Intronic
1171422079 20:25024276-25024298 CTAGGTTAGCCATGGAAGCTAGG - Intronic
1175995243 20:62809365-62809387 CCAGGTCACAGATGGCAGCAGGG + Intronic
1176963702 21:15188303-15188325 CTAGGAAACAGAGAGAAGCATGG + Intergenic
1178766118 21:35452443-35452465 GAAGGTTACAGATGGAATTAAGG - Intronic
1179317243 21:40254686-40254708 CTGGGATGCAGATGCAAGCAGGG - Intronic
1179452950 21:41478039-41478061 CTGGGTTACACACGGAATCAGGG - Intronic
1181330865 22:22089594-22089616 CGAGGGTACAGATGTCAGCAAGG + Intergenic
1182667872 22:31972433-31972455 CTATGTTAGAGCTGGCAGCATGG + Intergenic
1183224438 22:36539819-36539841 CTAGATCACAGAAGGCAGCATGG - Intergenic
1183996730 22:41639635-41639657 CTAGGCTACACATGGACACATGG - Intronic
951214261 3:20008723-20008745 CTAGGTTACAGAGGGAGACCAGG + Intronic
951808544 3:26674579-26674601 CTAGGTTATTCATGGAAGCAGGG + Intronic
955465290 3:59230552-59230574 CTAGGCTACACACGGCAGCAGGG + Intergenic
956581386 3:70818170-70818192 CTATGTTAAAGATGGAAGCAGGG + Intergenic
956808897 3:72845521-72845543 CTAGGGTAAAACTGGAAGCAGGG - Intronic
956934923 3:74089809-74089831 GTAGGTGACAGATGGGAGGAGGG - Intergenic
959804107 3:110530293-110530315 CTAGTTTAATGATGGAAGGATGG + Intergenic
961773184 3:129265114-129265136 CTGGGTGACAGATGGAGGCCGGG - Intronic
961864695 3:129945170-129945192 CGAGGTTACACCTAGAAGCATGG + Intergenic
961990151 3:131181110-131181132 TAAGGTTACAGATGGAACTAAGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963719061 3:148839033-148839055 TTAGGTTATAGATGGAATTAAGG + Intronic
963922142 3:150916136-150916158 CAAGAATACAGATGGAAGAAAGG - Intronic
964402462 3:156313551-156313573 CTAGCTTTGAGATGGAAGAAGGG + Intronic
965173820 3:165303477-165303499 GGAGTTGACAGATGGAAGCAAGG + Intergenic
965945395 3:174234216-174234238 TTAGGGTACACTTGGAAGCAGGG + Intronic
967048779 3:185762506-185762528 CTGGGTGACAGAGGGAAGCTCGG + Intronic
967219721 3:187238265-187238287 CTAATTTACAGATGGAAACATGG + Intronic
967459803 3:189732397-189732419 CAAGGTTACAGATGGAAGGGAGG + Intronic
968681660 4:1925142-1925164 CTAGGTTACAGATGGAAGCAGGG - Intronic
968788073 4:2639008-2639030 GTAGTTGACAGAGGGAAGCATGG + Intronic
970861190 4:20704586-20704608 CTGTGCTACAGATGGATGCAGGG + Intronic
970873073 4:20838668-20838690 ATAGGATATAGATGGTAGCAAGG + Intronic
971454381 4:26830303-26830325 CTAAGTTAAAGATGGGAGCTGGG - Intergenic
972428230 4:38955426-38955448 CTAGGTGGAAGATGGAAGTAAGG - Intergenic
974756756 4:66219098-66219120 CAAGATTACAGAAGGAAGAAAGG - Intergenic
977727993 4:100320095-100320117 CCATGATACAGATGGTAGCAAGG - Intergenic
978167418 4:105625582-105625604 CTAGGTAGCAGATGGAGACAAGG + Intronic
981050154 4:140301688-140301710 TGAAGTTACAGATGGAGGCATGG + Intronic
981541349 4:145849790-145849812 CGAGATCACAGATGGTAGCAGGG + Intronic
983393892 4:167168871-167168893 CTAGGCTACACATAGAAGCAGGG - Intronic
984059129 4:174970270-174970292 TAAGGTTGCAGATGGAATCAAGG + Intronic
984226954 4:177046589-177046611 ATATTTTACAGATGGAATCATGG - Intergenic
986572845 5:9182980-9183002 CTAGGCTCCAGATGCAGGCAGGG - Intronic
987170830 5:15255659-15255681 CCAGGTTAGAGATGGAGCCAAGG - Intergenic
987636529 5:20549496-20549518 GTAGGTTATAGAGGAAAGCACGG + Intronic
991929197 5:71735355-71735377 TAAGGTTACAGATGGAATTAAGG - Intergenic
993778541 5:92034867-92034889 TTAGGTTACAGATGGAAGTAAGG - Intergenic
995973605 5:118003915-118003937 CGAGGTTAAAGATGGAAGCAGGG + Intergenic
996489128 5:124071707-124071729 CTAGAATGCAGAAGGAAGCATGG + Intergenic
996692518 5:126355782-126355804 CTAGATAACAGATGGCAGCTTGG + Intergenic
997582515 5:135026732-135026754 CTATTTTACAGATGGAACCAAGG - Intergenic
997702485 5:135912521-135912543 CAAGGCTAGAGAAGGAAGCAGGG - Intergenic
1000248251 5:159468300-159468322 TTAGGTTGCAGATGGAATTAAGG + Intergenic
1001889489 5:175327375-175327397 CTAGGTAACTGATGGTAGGAAGG - Intergenic
1002447755 5:179300184-179300206 GAAGGTTACAGATGGAAGTCAGG - Intronic
1002871614 6:1171354-1171376 GTAGATGAGAGATGGAAGCAGGG - Intergenic
1003694465 6:8389524-8389546 TTCGGCTGCAGATGGAAGCAGGG - Intergenic
1004530939 6:16455101-16455123 CTAGGAGACAGAAGGAAGGAAGG + Intronic
1005946639 6:30600680-30600702 CAAGGTTCCAGGTGGGAGCAGGG + Exonic
1006076301 6:31534775-31534797 CGAGGTTCCAGATGGGTGCAAGG + Intronic
1006125868 6:31837694-31837716 ATAAGGTACAGAGGGAAGCAGGG + Intronic
1006601708 6:35230910-35230932 CTAGCATAGAGATGGAATCAAGG + Intronic
1006987279 6:38184343-38184365 TTAGGTTTCAGATGGCAGCACGG - Intronic
1007135237 6:39514362-39514384 CTAGATTACAGCTGGTACCAGGG - Intronic
1008964317 6:57298906-57298928 CTTGGTGACAGATGGAATAAGGG - Intergenic
1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG + Intergenic
1013911662 6:115282699-115282721 TCAGGTTCCAGATGTAAGCAAGG + Intergenic
1015138459 6:129901557-129901579 CTAGTTTACAGATGGACAGATGG - Intergenic
1016737931 6:147500663-147500685 GGAGCTTACAGATAGAAGCATGG + Intergenic
1018090568 6:160343904-160343926 CTCAGAAACAGATGGAAGCAGGG + Intergenic
1021899993 7:25275674-25275696 CTATGTGACAGATGAAGGCAGGG - Intergenic
1022589794 7:31650849-31650871 CTAGGTGACATAGGGATGCAAGG - Intronic
1024213516 7:47227473-47227495 CCAGGTTACACATGGGTGCACGG + Intergenic
1024270954 7:47641118-47641140 TCAGGTTACAGCTGGAGGCAGGG - Intergenic
1028517266 7:91691759-91691781 CTTAGTTACACAAGGAAGCAAGG + Intergenic
1028715010 7:93955768-93955790 CAAGTTTGCAGATGGAGGCATGG + Intergenic
1028895201 7:96033190-96033212 CTAGGCTACGGATACAAGCAAGG - Intronic
1030825620 7:114153952-114153974 CAAGGCAGCAGATGGAAGCATGG + Intronic
1033710810 7:143941711-143941733 GTAGGGTACAGAGGGAAACAAGG - Intergenic
1036006207 8:4666243-4666265 CAAGGTAACAGATGGAATCACGG + Intronic
1036507396 8:9367925-9367947 GAAACTTACAGATGGAAGCATGG + Intergenic
1036582463 8:10088181-10088203 GGTGGTTACAGATGGTAGCATGG - Intronic
1037546307 8:19926883-19926905 CTAGCCTACAGTTGGAGGCAGGG + Intronic
1038294422 8:26277908-26277930 CTTGGATCCAGATGGAAGCAAGG - Intergenic
1038584935 8:28779793-28779815 CTAGGTCACAAATGAAAGCTGGG + Intronic
1039178029 8:34831505-34831527 CTAGCTTCCAGATGAAATCATGG + Intergenic
1039664848 8:39513887-39513909 CTAGGTTCCAGAAGGAAGGCAGG - Intergenic
1042730805 8:71932023-71932045 ATATTTTAAAGATGGAAGCATGG + Intronic
1043299421 8:78707940-78707962 TTTAGTTACAAATGGAAGCAAGG - Intronic
1043738794 8:83780633-83780655 TTAGGTTACACTTGGTAGCATGG + Intergenic
1043800680 8:84605893-84605915 CTAGGTTTAACCTGGAAGCAGGG - Intronic
1045934790 8:107666739-107666761 CTGGGTTCCATATGGAAGAAAGG - Intergenic
1047787455 8:128167764-128167786 CGAGGCTGGAGATGGAAGCAGGG + Intergenic
1048008623 8:130438995-130439017 GAAGGTTGCAGATGGAATCAAGG + Intronic
1048469641 8:134695527-134695549 CTTGGTTAGAGATGCAGGCAGGG - Intronic
1049207912 8:141371961-141371983 CCAGGTTACAGCTGGCAGCTGGG + Intergenic
1050122547 9:2322142-2322164 CTAGGATGCAGATGAAAACATGG + Intergenic
1052177272 9:25477746-25477768 TAAGGTTACAGATGGAATTAAGG + Intergenic
1057423200 9:94928287-94928309 TTAGGTTTCTGATGGAAGCAAGG + Intronic
1057427732 9:94967235-94967257 AGAGGCTACAGATGGAGGCAGGG + Intronic
1057902056 9:98957069-98957091 TTAGGCTGCAGATGGAATCAAGG + Intronic
1060002124 9:119968407-119968429 TAAGGTTGCAGATGGAATCAGGG + Intergenic
1060008865 9:120025751-120025773 TTAGAATACAGATGGAAGGAAGG + Intergenic
1060152145 9:121295629-121295651 CAAGGTTACAGAGGAAAGGAGGG + Intronic
1060999464 9:127894926-127894948 CTAGGATACAGTGGGGAGCAAGG - Intronic
1185625142 X:1475955-1475977 CTAGGGTAGGGAAGGAAGCAAGG + Intronic
1185745185 X:2566956-2566978 GGAGGTTACAGATGCCAGCATGG + Intergenic
1187735573 X:22300430-22300452 CTGGGTTACATAAGGAAGCGAGG + Intergenic
1188262195 X:28034842-28034864 CTGGGTGACAGAAGGAAGCTAGG + Intergenic
1188660790 X:32755824-32755846 GTTGGTTACAGGAGGAAGCAGGG + Intronic
1191839277 X:65499529-65499551 CAAGTTTACAGATGGAGGAAAGG + Intronic
1192078592 X:68025140-68025162 CTTGGTTTCAGAAGGTAGCAAGG + Intergenic
1194278122 X:91913047-91913069 CTAGGTTAGAGGTGGAGGCTGGG - Intronic
1199791725 X:151161345-151161367 CTAGGTGACAGAGGGATGGAGGG - Intergenic
1200411967 Y:2869738-2869760 CTAAGAGACAGATGGAAGAAGGG + Intronic
1200595462 Y:5135122-5135144 CTAGGTTAGAGGTGGAGGCTGGG - Intronic