ID: 968684072

View in Genome Browser
Species Human (GRCh38)
Location 4:1944542-1944564
Sequence GCTCTCCAGTGTAAAACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968684064_968684072 19 Left 968684064 4:1944500-1944522 CCATCTTCCACACACTATGTCTG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 968684072 4:1944542-1944564 GCTCTCCAGTGTAAAACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 104
968684065_968684072 12 Left 968684065 4:1944507-1944529 CCACACACTATGTCTGTGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 968684072 4:1944542-1944564 GCTCTCCAGTGTAAAACTTGAGG 0: 1
1: 0
2: 3
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968684072 Original CRISPR GCTCTCCAGTGTAAAACTTG AGG Intronic
900695730 1:4009105-4009127 GCTCTACTGTGTAGAATTTGAGG + Intergenic
913331152 1:117669026-117669048 GCTCTACCATGTAAAACTGGTGG - Intergenic
916416644 1:164598453-164598475 TCTCTCCAGTCCAAACCTTGTGG + Intronic
916790945 1:168124719-168124741 GATCTCCAGTGTCAAAGGTGTGG + Intronic
917610813 1:176687283-176687305 GTTCTCCAGTGTAACACTCTTGG - Intronic
924443893 1:244110400-244110422 GGTCCCCAGTGTAAAACTAGAGG + Intergenic
1071161316 10:82749076-82749098 GGGTTCCTGTGTAAAACTTGAGG + Intronic
1076751470 10:132545568-132545590 GCACTCCAGTGAAATACCTGTGG + Intronic
1079458211 11:20655118-20655140 CCTCTGCAGGGTAAAACGTGTGG - Exonic
1081787450 11:45757402-45757424 GCTGGCCCCTGTAAAACTTGAGG + Intergenic
1082762721 11:57143088-57143110 GCTCTACATGGTAAAACTAGGGG + Intergenic
1087679422 11:101202943-101202965 TCTCTCCAGTGCAAAGCTTTAGG - Intergenic
1088011507 11:105007077-105007099 GATCACCAGTGTAAAACGTAAGG - Exonic
1089461595 11:118657305-118657327 GATCTCAAGTGTCAACCTTGAGG + Exonic
1089592699 11:119554847-119554869 TGTCTCCTGTGTCAAACTTGAGG - Intergenic
1089905678 11:122035807-122035829 GCTGTCAAGTGTAAATGTTGAGG - Intergenic
1092345355 12:7710075-7710097 TCTCTCCAGTGAAATTCTTGCGG + Intergenic
1092975356 12:13739614-13739636 ACTCCCCGGTGTAATACTTGTGG + Intronic
1093824164 12:23661476-23661498 GCTCTCAAGTATAAAATTTTAGG + Intronic
1096616964 12:52838778-52838800 GCTCTCCAGTGTGTTCCTTGGGG - Intronic
1102352380 12:112203406-112203428 GCTCTCCAGTCTCAAAGCTGTGG - Intronic
1108523779 13:51267961-51267983 GCTCTTCCATGTAAAGCTTGGGG + Intronic
1109514444 13:63423755-63423777 ACTTGCCACTGTAAAACTTGGGG + Intergenic
1113549758 13:111183851-111183873 TCTCTCCTGTGTAAAAGATGAGG + Intronic
1117741636 14:58825012-58825034 GCTATCCATTGTGAAAATTGTGG + Intergenic
1120459538 14:84777045-84777067 GGTCTTAAGTGGAAAACTTGAGG + Intergenic
1120573223 14:86147777-86147799 GATATCCAGTGTAGAACTGGTGG - Intergenic
1122154620 14:99742677-99742699 GGGCTCAACTGTAAAACTTGTGG + Intronic
1126126151 15:45296332-45296354 GATCTCCAGTGTTAGAGTTGGGG - Intergenic
1126710827 15:51454293-51454315 GCTGTCCTGTGTGAAACTTCAGG - Intronic
1127392442 15:58517523-58517545 GCTCTCCACACTGAAACTTGTGG - Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1139526586 16:67520479-67520501 TCTCTCCAGGGTACAACTTCAGG - Intronic
1140801142 16:78489649-78489671 GCTCTCCAGGGTAAAAGAAGAGG + Intronic
1140877463 16:79165965-79165987 GCTCTCCTGTGAAAATCTTTCGG + Intronic
1145120464 17:20254965-20254987 TCTCTCCCATGTAAAACTCGAGG - Intronic
1147470426 17:40653710-40653732 GTTTTCAAGTGTAAAACTTGAGG + Intergenic
1149039149 17:52166936-52166958 GCTATCCAGTGTGAAGATTGGGG + Intergenic
1149169745 17:53794824-53794846 GCTCCCCAGTGGAATACTTTGGG - Intergenic
1152686101 17:81694522-81694544 GCTGTCCAGTGTCCACCTTGAGG + Intronic
1155050814 18:22146345-22146367 TCACTCCAGTTTAAAACTTTAGG - Intergenic
1158582498 18:58696698-58696720 GTTCTCCACTCTAAAAATTGTGG + Intronic
1159627516 18:70711938-70711960 GCACAACAGTGTACAACTTGAGG + Intergenic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1164891079 19:31824160-31824182 ACTCCTCACTGTAAAACTTGTGG - Intergenic
1166333986 19:42094547-42094569 GCTCTTCACTGTAAAACTTGGGG + Intronic
925630412 2:5886836-5886858 GCTTTGCAATGTAAAAATTGTGG + Intergenic
930413336 2:51055452-51055474 GCGCAACAGTGAAAAACTTGTGG - Intergenic
932488489 2:72103411-72103433 GCTCTCCCTTGGGAAACTTGTGG + Intergenic
932640730 2:73443191-73443213 GCTTTCCATTGTTAACCTTGGGG + Intronic
940343762 2:152608106-152608128 GCACTCAAGCGTAAAACTTCTGG - Intronic
947542090 2:230986499-230986521 CCTCTCCTGTATAAAACTGGGGG + Intergenic
948297145 2:236869301-236869323 TCACTCCAGTTTCAAACTTGAGG - Intergenic
1170544322 20:17421410-17421432 GCTCTACAGGGTAAGACTTTGGG - Intronic
1178397071 21:32252109-32252131 TCACTGCAGTGTCAAACTTGTGG - Intergenic
952158075 3:30665540-30665562 GCTCCGCAGTGTAGAATTTGAGG - Intronic
953270007 3:41432455-41432477 GCTCTTCTGTGTAATCCTTGGGG + Intronic
953589614 3:44238894-44238916 GCTTTCAAATGGAAAACTTGAGG - Intergenic
953637388 3:44674677-44674699 GCTCACTGGTGTAACACTTGGGG + Intergenic
955813442 3:62816713-62816735 GCTCTCCTGTGAAAAATGTGAGG - Intronic
960149514 3:114236684-114236706 TCTCTCCAGTGTGAATCTGGCGG + Exonic
961475168 3:127141493-127141515 GCTCTCACCTGTAAAACTGGGGG + Intergenic
962440000 3:135404779-135404801 GCTCTCCAGTGGTTAACTTCTGG + Intergenic
962846869 3:139280929-139280951 GCTCTCCAGCTTAAAACGGGAGG - Intronic
965747442 3:171940065-171940087 GCTCTTTTGTATAAAACTTGAGG - Intergenic
966668093 3:182495524-182495546 GGTCTACGGTGAAAAACTTGAGG + Intergenic
968684072 4:1944542-1944564 GCTCTCCAGTGTAAAACTTGAGG + Intronic
973856409 4:55015060-55015082 GCTGTGCAGTGTGAAACTTAGGG - Intergenic
977118395 4:93063577-93063599 GCTGTCAAGTGTAAAAATTGTGG + Intronic
979204434 4:118020513-118020535 TCTCTCCAGTGTAATACTTGGGG + Intergenic
984315341 4:178122458-178122480 GGGCTCCAGTGTAAAAGTAGTGG + Intergenic
986452215 5:7877935-7877957 ACTGTCCAGTTTAGAACTTGTGG + Exonic
987233063 5:15915103-15915125 GCTCTGCAATGTAAATTTTGGGG + Intronic
990637916 5:57750270-57750292 GCTTTACAGTGGAAAACCTGGGG + Intergenic
990972419 5:61523206-61523228 GCTCCCCAGGGTAGAGCTTGTGG + Intronic
1000227950 5:159287030-159287052 GCTCTTCAGTGTAAAAGGTAAGG + Intergenic
1001787034 5:174422575-174422597 GCCATCCAGTGAAAAACTTGGGG + Intergenic
1005106214 6:22227234-22227256 GCTTCCCATTGAAAAACTTGTGG + Intergenic
1009709012 6:67293332-67293354 ACTCTCCAGTGCAAAACTTGAGG - Intergenic
1010168759 6:72949787-72949809 GCTTTCCAGTGTAATTTTTGTGG - Intronic
1015545071 6:134353546-134353568 GGTCTCCTGTTTAAAATTTGTGG - Intergenic
1016451771 6:144190059-144190081 ACTCTCCAATATAAAACGTGAGG - Intergenic
1016802387 6:148179879-148179901 GCTCTCCATTGTACAATGTGTGG - Intergenic
1017523527 6:155222655-155222677 GCTCCTCAGTGTAAGACTTAGGG - Intronic
1020670835 7:11108865-11108887 GATTTCTAGTGTATAACTTGAGG - Intronic
1022358715 7:29639729-29639751 GCTCTCCAGTGTATGGCTTGTGG - Intergenic
1027425212 7:78055119-78055141 TCTATCCAGTGTTAAACATGAGG + Intronic
1030133156 7:106220164-106220186 CCTCTTAAGTGTAAAACTTTGGG - Intergenic
1036987466 8:13551563-13551585 GCTCTCAACTATAAAACTTCTGG + Intergenic
1038936744 8:32260220-32260242 GCTCTCCAGTGAAAAGCATGGGG + Intronic
1039159923 8:34606290-34606312 TCTCTCCAGTGTACAATTTTAGG - Intergenic
1043558414 8:81461469-81461491 GGTCTCCAGTGAAAACTTTGAGG - Exonic
1044079495 8:87866116-87866138 GCTCTACAGTCTAAATCTTTAGG + Intergenic
1047345932 8:124028595-124028617 GCTCTACAGAATAAAGCTTGAGG - Intronic
1048356426 8:133657489-133657511 GGGCTCCAATTTAAAACTTGGGG + Intergenic
1049865279 8:144931496-144931518 TCTCTCCAGTGTGAACCCTGTGG + Exonic
1052580368 9:30347737-30347759 GTTGGCCAGTGTAAAAATTGTGG - Intergenic
1054949482 9:70834275-70834297 GCTCTGCAGTGTGCAACTTAAGG - Intronic
1057070045 9:92089643-92089665 GCTCTACAGGGAAAAACTGGAGG + Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1061790989 9:133058768-133058790 GCTGCCCAGTGTGAAACTAGTGG + Intergenic
1062689671 9:137834767-137834789 GCTCTCCATAGTCAAACCTGGGG - Exonic
1185748897 X:2594624-2594646 GTTGTCCAGTGTAAGACTTAGGG + Intergenic
1187373410 X:18728930-18728952 GCTCTTCACTCTAAAACTCGAGG + Intronic
1188558916 X:31445336-31445358 GCTCTCATGGGTAAAAATTGAGG + Intronic
1188678729 X:32975696-32975718 GCTCTGAAATGTAAGACTTGAGG + Intronic
1190731971 X:53232561-53232583 TTTCCTCAGTGTAAAACTTGGGG - Intergenic
1194011439 X:88567214-88567236 GTTCTCCAATGTAAAACTCCTGG + Intergenic
1194829989 X:98611657-98611679 GTTCTCTAGTGTAAAACCAGAGG - Intergenic
1195370078 X:104165119-104165141 GCTGACCAATTTAAAACTTGTGG - Intergenic
1195422146 X:104687510-104687532 GATCTCCAGTGTCAAAGGTGGGG - Intronic
1198837398 X:140819342-140819364 TTTCTCCAGTGAAAAGCTTGGGG + Intergenic
1199729490 X:150617344-150617366 GCTCTCCAGTATTGCACTTGTGG + Intronic
1200454671 Y:3374909-3374931 GCTCTGAAGTGTAAAAGTTTGGG - Intergenic