ID: 968688981

View in Genome Browser
Species Human (GRCh38)
Location 4:1980336-1980358
Sequence GCCTTTGCCCACGTGTCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968688972_968688981 20 Left 968688972 4:1980293-1980315 CCCTGGGAAGTCTGGAGCACCCT 0: 1
1: 0
2: 1
3: 19
4: 167
Right 968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 148
968688971_968688981 26 Left 968688971 4:1980287-1980309 CCTTGACCCTGGGAAGTCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 266
Right 968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 148
968688979_968688981 0 Left 968688979 4:1980313-1980335 CCTGAGAAGGGGGCACCATGTGT 0: 1
1: 1
2: 2
3: 14
4: 152
Right 968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 148
968688973_968688981 19 Left 968688973 4:1980294-1980316 CCTGGGAAGTCTGGAGCACCCTG 0: 1
1: 0
2: 1
3: 46
4: 314
Right 968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 148
968688978_968688981 1 Left 968688978 4:1980312-1980334 CCCTGAGAAGGGGGCACCATGTG 0: 1
1: 0
2: 1
3: 8
4: 176
Right 968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968688981 Original CRISPR GCCTTTGCCCACGTGTCCTG AGG Exonic
900856604 1:5190399-5190421 TCCTTTGCCAACGTGTCTTCAGG - Intergenic
901650979 1:10743155-10743177 GCCTCTGCCCCTCTGTCCTGAGG - Intronic
903214097 1:21833644-21833666 GCCTTGGCCCACGGCTCCAGGGG + Intronic
903285271 1:22273030-22273052 GCCTTTGCCCAGGAGTCCACGGG - Intergenic
904696502 1:32334703-32334725 GCCTCTGCCCCCTTGGCCTGGGG + Exonic
907993844 1:59609406-59609428 GCCTCTGGCCATGTGTCCTCAGG - Intronic
912853326 1:113145762-113145784 GCCCTTGCCCATGTGGCCTTGGG - Intergenic
913611528 1:120514075-120514097 GCCCTTGCCCAGCTGCCCTGCGG + Intergenic
913983264 1:143542732-143542754 GCCCTTGCCCAGATGCCCTGTGG - Intergenic
914579664 1:149008164-149008186 GCCCTTGCCCAGCTGCCCTGCGG - Intronic
915587324 1:156851338-156851360 TCCTTTGCCCTCGTGTCCCTGGG - Exonic
915598478 1:156908346-156908368 TCCTTTGACCACATGTCCCGCGG - Intronic
916518314 1:165540909-165540931 GCCTGTGCCCACCTGTCCTTTGG + Intergenic
918934248 1:190899427-190899449 GCCTTTGCTCTCATGTCCAGGGG - Intergenic
920815477 1:209327462-209327484 TCCTTTGCCTACATGTCTTGCGG - Intergenic
1063175071 10:3543771-3543793 GCAGATGCCCAGGTGTCCTGTGG - Intergenic
1063661254 10:8036255-8036277 GACTTTGCACACGTGACATGGGG + Intergenic
1064582748 10:16810622-16810644 GTCTTTGCCCACCTGTCCCATGG - Intronic
1067078262 10:43200166-43200188 GCCTTGGCCCACTTACCCTGTGG + Exonic
1075641745 10:124069717-124069739 GCCTCTGCCCAGGTGTCCTATGG - Intronic
1076319937 10:129570429-129570451 GTCTGTGCCCACGTGTCACGAGG + Intronic
1076388757 10:130079819-130079841 GCCTGTGCCCTGGCGTCCTGGGG - Intergenic
1079224756 11:18595649-18595671 GCTTTTCCCCACGTGTCATCAGG - Intergenic
1079828784 11:25234533-25234555 GCCTTTGCCCCCATGTCCTGAGG - Intergenic
1081741155 11:45441700-45441722 GCCTTTGCCCCGGTGTTCTTGGG - Intergenic
1083996971 11:66277624-66277646 GCCCTTGACCCCGTTTCCTGAGG + Intergenic
1084475257 11:69385206-69385228 CTCTTTGCCCACAGGTCCTGGGG + Intergenic
1088907891 11:114168782-114168804 CCCTGTGCCCAAGGGTCCTGGGG + Intronic
1090884341 11:130862562-130862584 GCCTTTCCCCAGGAGTCCTCTGG + Intergenic
1096520397 12:52181572-52181594 GCATGTGCCCACGTGTACAGGGG + Intronic
1102258584 12:111430025-111430047 TCCTGGGCCCACGTCTCCTGGGG + Intronic
1108321001 13:49290514-49290536 GCCCTGGCCCAGGTGTCCTTAGG + Intronic
1112022997 13:95387867-95387889 GCCTTTGCCCAAGTTGGCTGTGG - Intergenic
1119023632 14:71135766-71135788 CCCTTGGCCCACAGGTCCTGTGG + Intergenic
1120371313 14:83639757-83639779 GCCATTGCCCAGGCGTGCTGAGG + Intergenic
1120856096 14:89213732-89213754 GCCCTTTCCCATTTGTCCTGGGG + Intronic
1121333794 14:93064468-93064490 GGCTTTGATCAGGTGTCCTGGGG - Intronic
1122293284 14:100691051-100691073 GCCTTTGCCCAACTGACCTCAGG + Intergenic
1122919722 14:104875023-104875045 GCCCTTGCCCAGGGGTGCTGGGG + Intronic
1123931977 15:25176324-25176346 GCCTGTGCCCAGTAGTCCTGGGG + Intergenic
1123933656 15:25183798-25183820 GCCTGTGCCCAGTAGTCCTGGGG + Intergenic
1129595515 15:76960963-76960985 GACGTTGCCCAAGTGTCCCGGGG + Intergenic
1130933504 15:88449474-88449496 GCTTTTGCCCACATGCCATGTGG - Intergenic
1132879841 16:2157260-2157282 GCCTCGGGCCCCGTGTCCTGAGG + Intronic
1132973522 16:2700513-2700535 GCCATGCCTCACGTGTCCTGAGG - Intronic
1133116661 16:3581509-3581531 GCCTGAGACCAGGTGTCCTGAGG - Exonic
1134063178 16:11211161-11211183 GTCTTTGCCCAGGTGCCCTGAGG + Intergenic
1134386769 16:13780859-13780881 GCCAGTCCCCATGTGTCCTGGGG + Intergenic
1138266307 16:55662270-55662292 GCCTTTCTCCACTTGTGCTGTGG - Intronic
1141621321 16:85238092-85238114 GCCTTGGGCCACATGGCCTGTGG + Intergenic
1144715365 17:17431649-17431671 GCCCTTGCCCCCGAGTCCTGAGG + Intergenic
1144968762 17:19094002-19094024 GCCTTGGCCCATCTGCCCTGTGG + Exonic
1144979154 17:19158064-19158086 GCCTTGGCCCATCTGCCCTGTGG - Exonic
1144989068 17:19220168-19220190 GCCTTGGCCCATCTGCCCTGTGG + Exonic
1145025273 17:19463643-19463665 CCTGTTGCCCAGGTGTCCTGAGG - Intergenic
1146476457 17:33166583-33166605 GCCTTCACCCAGGGGTCCTGTGG - Intronic
1146804669 17:35855739-35855761 GCCTCTGCCAGGGTGTCCTGGGG - Exonic
1147137154 17:38441032-38441054 GCCTCTGCCCACCTGCGCTGTGG - Intronic
1149370702 17:55991237-55991259 GCTTTTGGCCACCTGTCCTGAGG + Intergenic
1151434950 17:74089340-74089362 GCCTTTGCCCTTGAGGCCTGTGG - Intergenic
1151815649 17:76470248-76470270 GCCTTTGCCCACCTGCCAGGAGG - Intergenic
1152204549 17:78967577-78967599 GGCCTTGGCCACGTGACCTGTGG + Intergenic
1152525955 17:80888511-80888533 CCCCTTGCCCACCTGCCCTGAGG - Intronic
1161104551 19:2436899-2436921 GTCTTTTCCCAGGTGCCCTGTGG + Intronic
1161593726 19:5140850-5140872 GCCTCTGCACACGTGTCTCGTGG + Intronic
1161605758 19:5214056-5214078 CTCTTTGCCCACTTGTCCTCTGG - Intronic
1162007513 19:7789561-7789583 GCCTCTGCCCACGTGGTCTTCGG - Intergenic
1162954213 19:14089660-14089682 GGCTTTGCGCGCGTTTCCTGCGG - Intronic
1167062370 19:47157646-47157668 GCCTTTGCCCACCATTCCGGAGG + Intronic
926068686 2:9866255-9866277 CCCTTTGCCCACATTTCATGGGG - Intronic
932542305 2:72668033-72668055 TCCTTTGCCCACTTTTACTGGGG - Intronic
934529297 2:95075151-95075173 GCCTTCACCCACCTGCCCTGGGG - Intergenic
941086632 2:161125784-161125806 GCCTTGGCCCACGTGCACTTTGG + Intergenic
941199156 2:162488028-162488050 TCCTTTGCCCTCCTGGCCTGAGG - Intronic
942236958 2:173920200-173920222 GCCTTTTCCAACGTGTCATATGG - Intronic
946176332 2:217923979-217924001 GCTTTTTCCCTCATGTCCTGGGG - Intronic
948037867 2:234873699-234873721 GCCTTCCCACACGGGTCCTGAGG - Intergenic
948637643 2:239349622-239349644 GCCTCTGCCCACGTCTCAGGCGG - Intronic
1168875464 20:1169173-1169195 GACTTGGTCCATGTGTCCTGGGG - Intronic
1171411963 20:24953555-24953577 TCCTGTGACCATGTGTCCTGGGG + Intronic
1173128095 20:40358872-40358894 GACTTTGCCAATGTCTCCTGGGG - Intergenic
1173563392 20:44022070-44022092 GCCATTGCTCACTTGTGCTGTGG - Intronic
1173866435 20:46315398-46315420 GCCTTTGCCCATGTGGTCTCTGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1176075339 20:63245661-63245683 GCCTCTGCCCAGCTGTGCTGGGG - Intronic
1176795789 21:13370703-13370725 GCCTCTGCCCCTGTGGCCTGAGG + Intergenic
1178155899 21:29853973-29853995 GCCTTTGCTCAGATGTCATGGGG - Intronic
1179680881 21:43020594-43020616 GCCTGTGCCCTCCTGTTCTGCGG + Intronic
1179708362 21:43195297-43195319 GCCTCAGCCCTCCTGTCCTGGGG + Intergenic
1180092372 21:45539691-45539713 GGCTTTGCCTAAGTGGCCTGGGG - Intronic
1180305430 22:11068866-11068888 GCCTCTGCCCCTGTGGCCTGAGG - Intergenic
1181051504 22:20240281-20240303 GCCTGTGCCCACAGGTGCTGAGG - Intergenic
1181286617 22:21757069-21757091 ACCTTTGCCCTAGTGTCCTAGGG + Exonic
1181419283 22:22786523-22786545 GCCTTTGCCCAAATGGCCAGAGG + Intronic
1182270145 22:29148262-29148284 ACCTTTGCCCATGTTTCCTTGGG - Intronic
1183494175 22:38133066-38133088 GGCAGTGCCCACGTGTCCCGGGG - Intronic
1183780853 22:39997998-39998020 ACCTCTGCCCACGTGACCTCTGG - Intronic
1184735775 22:46396995-46397017 GCCATTCCCCATGTGTCCTGGGG - Intronic
1184839527 22:47044315-47044337 GCCTTTCCCCAGGAGTCCTTTGG + Intronic
1185265657 22:49901379-49901401 GCTGTTGCCCAGGTGCCCTGGGG - Exonic
954174350 3:48831959-48831981 GTCTTTGCACACGTATCTTGTGG + Intronic
960670814 3:120154096-120154118 GCCTCAGCCCAAGTTTCCTGAGG - Intergenic
961449091 3:126994453-126994475 CCCTCTGCCCATGTGGCCTGTGG - Intronic
963805313 3:149715627-149715649 GCCTTTGCCCAAGTTTTCTCAGG - Intronic
968688981 4:1980336-1980358 GCCTTTGCCCACGTGTCCTGAGG + Exonic
969275215 4:6130133-6130155 GACTTTGCCAAAGTGGCCTGGGG - Intronic
975673489 4:76804257-76804279 TCCCTCGCCCATGTGTCCTGTGG + Intergenic
979308934 4:119179278-119179300 GCCTTTGCCCTTGTTTCCTTAGG + Intronic
984731517 4:183072888-183072910 GCTTTTACCCACTTTTCCTGAGG - Intergenic
985594138 5:780695-780717 GCCAGTGCCCACGTGTCCCCAGG - Intergenic
985653967 5:1120372-1120394 GTCTTTGCCCTCTTGTCCTCCGG - Intergenic
986339319 5:6775849-6775871 GCCTTTCTCCACGGGACCTGGGG + Intergenic
988317976 5:29656372-29656394 TCCTTTGCCCACGTTTTTTGGGG + Intergenic
994753078 5:103763416-103763438 GCCTTTGCCCAAGTTTGCTTGGG + Intergenic
997630051 5:135360438-135360460 GCCTGTGCCCACCTGTCCCTTGG + Intronic
999529282 5:152444458-152444480 GCCTTTGTCCGTGTGTCCTTAGG - Intergenic
1001977574 5:176012665-176012687 GCCATTGCACTCTTGTCCTGGGG + Intronic
1002164187 5:177334445-177334467 GTCTTGGGCCACGTGCCCTGCGG - Intronic
1002239847 5:177831104-177831126 GCCATTGCACTCTTGTCCTGGGG - Intergenic
1003475168 6:6475000-6475022 CACTTTGCCTACGTGTCCTCAGG - Intergenic
1004161841 6:13221192-13221214 GCCATTGCCCAAGTACCCTGTGG - Intronic
1005654396 6:27919140-27919162 GTCATTGCCCATGTGTCCTTAGG - Intergenic
1010790417 6:80057856-80057878 GCCTTTCCCCATCTGTCCAGGGG + Intergenic
1013316083 6:108944469-108944491 GCCTGTGCCCATCTCTCCTGAGG - Intronic
1015927549 6:138325350-138325372 GGCTTTTCCCAGCTGTCCTGAGG + Intronic
1018252732 6:161888467-161888489 AACTTTGCCCACCTCTCCTGGGG + Intronic
1019153948 6:170026378-170026400 GCCTTTGACCAGGAGGCCTGTGG + Intergenic
1019393788 7:805509-805531 ACCTTTGCCCTCTTGTCCTGGGG - Intergenic
1020351254 7:7221010-7221032 GCTTTGACCCACGCGTCCTGAGG + Intronic
1028024741 7:85822287-85822309 GCCTTTGCCCAAGTTTTCTTGGG - Intergenic
1028643303 7:93068316-93068338 TCCTTTGCCCACTTTTCATGGGG + Intergenic
1029243473 7:99181494-99181516 TCCTCTGTCCATGTGTCCTGTGG - Intronic
1030303297 7:107995631-107995653 GCCTTTGCACCCTTGCCCTGAGG + Intronic
1033275627 7:139969704-139969726 CCCTTTGCCCAGGTCTGCTGGGG + Intronic
1035756956 8:2041866-2041888 GCCTGTGCACACGTGCTCTGTGG + Intergenic
1036800789 8:11789439-11789461 GCCTGTGACCACCTGTGCTGTGG + Intergenic
1042363497 8:67909265-67909287 GCCTTAGCCCATGTGTGTTGGGG + Intergenic
1048807855 8:138257220-138257242 ACCATTGCCCACGTGTCCAGAGG + Intronic
1048970748 8:139643766-139643788 GGCTTTGGCCAGGGGTCCTGGGG - Intronic
1053886468 9:42647642-42647664 GCCTCTGCCCCTGTGGCCTGAGG - Intergenic
1054225487 9:62455091-62455113 GCCTCTGCCCCTGTGGCCTGAGG - Intergenic
1055748072 9:79472871-79472893 GACTCTGAACACGTGTCCTGTGG - Intergenic
1055944438 9:81680298-81680320 GCCTTTGGTTACCTGTCCTGTGG - Intronic
1060722367 9:125987554-125987576 GCCTCTGCCCAAATCTCCTGGGG + Intergenic
1186636364 X:11409398-11409420 GCCTGTGGCCACATGTCCTCTGG + Intronic
1188063372 X:25628172-25628194 GCCTTTGCCCACTTTTTATGGGG + Intergenic
1190224755 X:48536642-48536664 ACCTTTGCCCCAGTGTCCTTAGG + Intergenic
1190416220 X:50182957-50182979 GCCTTTGTCAATGAGTCCTGTGG - Intergenic
1192724491 X:73733766-73733788 GCCTTTGCCCACTTTTAATGGGG + Intergenic
1192795668 X:74422386-74422408 ACCTTTGCCCCTGTGTGCTGGGG + Intronic
1199414113 X:147559977-147559999 GCCTTTCCCCAAGGGTCTTGGGG - Intergenic
1200032341 X:153306851-153306873 GCCTTTGCCCATGTGACCACAGG + Intergenic
1200080449 X:153573612-153573634 GCCTTGGACCAGGGGTCCTGGGG - Intronic