ID: 968692284

View in Genome Browser
Species Human (GRCh38)
Location 4:1998740-1998762
Sequence TCTCTAGGTTGAGGAAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 13, 3: 79, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968692284_968692288 -2 Left 968692284 4:1998740-1998762 CCAGAACTTCCTCAACCTAGAGA 0: 1
1: 0
2: 13
3: 79
4: 201
Right 968692288 4:1998761-1998783 GACAGGCCAACATGCAAATTTGG No data
968692284_968692289 -1 Left 968692284 4:1998740-1998762 CCAGAACTTCCTCAACCTAGAGA 0: 1
1: 0
2: 13
3: 79
4: 201
Right 968692289 4:1998762-1998784 ACAGGCCAACATGCAAATTTGGG 0: 6
1: 157
2: 1424
3: 3948
4: 3877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968692284 Original CRISPR TCTCTAGGTTGAGGAAGTTC TGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903113962 1:21162634-21162656 TCTGTAGGCTGAGGAAGGACAGG + Intronic
903770929 1:25763927-25763949 TCACTGGGCTGAGGAAGTTGGGG - Exonic
905273235 1:36800675-36800697 TCTCTAGGTTTGGTAAGTCCAGG + Exonic
906363183 1:45181522-45181544 TTGCTAGATTGGGGAAGTTCTGG - Intronic
906570002 1:46829700-46829722 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
907994157 1:59612087-59612109 TAGCTAGGTTGGGGAAGTTCTGG - Intronic
911707127 1:101026395-101026417 TCTTTAGGTACAGGAAGGTCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912676066 1:111681787-111681809 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
914218315 1:145654810-145654832 TTGCTAGGTTGGAGAAGTTCTGG + Intronic
914470875 1:147977501-147977523 TTGCTAGCTTGAAGAAGTTCTGG + Intronic
914957939 1:152181553-152181575 TCCCTAGGTTCAGCCAGTTCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916434063 1:164760331-164760353 TTTCCAAGTTGAGGAAGTTTGGG + Intronic
916878569 1:168997150-168997172 TTTCTAGGTTGGGGAAGTTCTGG + Intergenic
917259878 1:173155313-173155335 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
919164266 1:193872465-193872487 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
919425949 1:197430588-197430610 TCTCTGGGTTAAGAGAGTTCAGG - Intronic
919461492 1:197883083-197883105 TTGCTAGGTTGGGGAAGTTGTGG + Intergenic
920873876 1:209816515-209816537 TCTCTAGGGGGAGGATCTTCAGG - Intergenic
924629727 1:245725282-245725304 TTTCTAGGTTGGGGAAGTTCTGG - Intergenic
1063815960 10:9772070-9772092 TCTCTAGATTTGGGAAGTTTGGG - Intergenic
1064829367 10:19444859-19444881 TTGCTAGGTTGGGGAAGTTCTGG + Intronic
1065254813 10:23855565-23855587 TTGCTAGATTGGGGAAGTTCTGG + Intronic
1069333933 10:67326774-67326796 TAGCTAGGCTGGGGAAGTTCTGG + Intronic
1071067428 10:81653271-81653293 TCGCTAGGTTGGGAAAGTTCTGG + Intergenic
1071844484 10:89507165-89507187 TTGCTATGTTGGGGAAGTTCTGG - Intronic
1072876349 10:99176711-99176733 TTGCTAGGTTGAGGAAGTTCTGG - Intronic
1073927518 10:108534127-108534149 TCGCTATGTTGGGGAAGTTCTGG - Intergenic
1075783347 10:125031547-125031569 ACTTTGGGTTGAGGACGTTCGGG - Intronic
1075860685 10:125673971-125673993 TTTTTAGGTTGGGGAAGTTCTGG + Intronic
1078363926 11:10691562-10691584 TATCTTGGGTGAGGAAGTTAGGG - Intronic
1079653866 11:22964457-22964479 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
1079696278 11:23485607-23485629 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1079966221 11:26983457-26983479 TTGCTAGGTTGAGGAAGTTCCGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081252186 11:40849689-40849711 TTGCTAGGTTGGGGAAGTTCTGG + Intronic
1082757136 11:57088588-57088610 TCTCGAGGTTGAGGAATGACTGG + Intergenic
1086771525 11:90773691-90773713 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088490913 11:110387317-110387339 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1092560903 12:9611901-9611923 TTGCTATGTTGGGGAAGTTCTGG - Intergenic
1092852559 12:12643737-12643759 TCTCTATGTTTTGGAAGTTGGGG + Exonic
1093085791 12:14865885-14865907 TTGCTAGGTTGGGGAAGTTCTGG + Intronic
1093413503 12:18894775-18894797 TTTCTAGGTTGGGGAAGTTCTGG + Intergenic
1093691995 12:22119378-22119400 TCTATAGGAGGAGGGAGTTCTGG - Intronic
1095229526 12:39722706-39722728 TCTGTAAGATGAGGAATTTCAGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096520028 12:52179837-52179859 TTTCAAGGGTGAGGAGGTTCAGG - Intronic
1096922302 12:55100810-55100832 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
1096973359 12:55684703-55684725 CCTCTAGGTTAAGGCACTTCCGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098669165 12:73202816-73202838 TCTCTAGGTTGAGGATATTTAGG - Intergenic
1098912771 12:76226495-76226517 GCTCTAAGATGAGTAAGTTCTGG - Intergenic
1099108059 12:78520512-78520534 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1099902565 12:88729713-88729735 TCTTTAGGGTGATGAAGCTCTGG - Intergenic
1102383051 12:112483839-112483861 TTTCTAGCTTGAGAAAGGTCCGG + Intronic
1103203480 12:119109371-119109393 CCGCTAGGTTGGGGAAGTTCTGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104780781 12:131418749-131418771 TCTCCAAGATGAGTAAGTTCTGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108226126 13:48291479-48291501 TCTCTAGGGTGTGGAATTGCTGG + Intergenic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1110300395 13:73919927-73919949 TCTATAAGTTGAGAAAATTCAGG - Intronic
1110603740 13:77407236-77407258 TCTGGAGCTAGAGGAAGTTCTGG + Intergenic
1110821674 13:79924762-79924784 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1112643832 13:101306864-101306886 TCTTTGTGTGGAGGAAGTTCAGG + Intronic
1113122812 13:106942489-106942511 TCTCTTGCTTGGGGAAGGTCAGG - Intergenic
1113347802 13:109497685-109497707 TCTCTACATTGGGGCAGTTCAGG + Intergenic
1114851431 14:26386765-26386787 TCTCAAGGCTGAGGAAGCTGAGG + Intergenic
1115464833 14:33703570-33703592 TTTCTAGGTTAAGAAAATTCTGG + Intronic
1116312167 14:43341194-43341216 TCACTAGGTTGCAGAGGTTCTGG + Intergenic
1116482912 14:45412991-45413013 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1116719803 14:48481928-48481950 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
1117899900 14:60521033-60521055 TCTCAAGGTTCTGCAAGTTCAGG + Intergenic
1118558397 14:67051548-67051570 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
1119930426 14:78541167-78541189 TTGCTAGGTTGGGGAAGTTCTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120627301 14:86844260-86844282 TGTTTTGGTTGAGAAAGTTCTGG - Intergenic
1124431064 15:29608892-29608914 TCTCTAGTGCGAGGTAGTTCAGG - Intergenic
1125232106 15:37468130-37468152 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1125296714 15:38211319-38211341 TCTGAAGGATGAGGAAGTACTGG + Intergenic
1125367733 15:38936885-38936907 TTTCTATGTTGAAGCAGTTCTGG + Intergenic
1126953177 15:53905668-53905690 TGTGTAGGATGAGTAAGTTCTGG + Intergenic
1127317714 15:57813681-57813703 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1127373895 15:58364493-58364515 TTGCTAGATTGGGGAAGTTCTGG - Intronic
1127774188 15:62252781-62252803 TCTCTAGGCTGAGGGAGTCAGGG - Intergenic
1129057742 15:72833812-72833834 TCCATAGTGTGAGGAAGTTCAGG + Intergenic
1130431154 15:83848280-83848302 TATTTAGGTTGATGTAGTTCCGG + Intronic
1133258933 16:4536088-4536110 CCTGTAGGTGGAGGAAGTGCTGG - Intronic
1133727951 16:8554838-8554860 TCTTAAGGATGAGGAAGTTGAGG + Intergenic
1133825160 16:9271744-9271766 TTTCTAGGTTGATGAAATTCAGG + Intergenic
1138206789 16:55131209-55131231 TCTCAAAGTTGAGGAAGCTGAGG - Intergenic
1139122663 16:64039501-64039523 TCTCTCAGTTGAGGAAATTAAGG - Intergenic
1141377616 16:83546481-83546503 TCTCTGGGTTCAAGACGTTCTGG + Intronic
1143032404 17:3975046-3975068 TCTCTAGGGTGGGGATGTCCTGG + Intergenic
1143593541 17:7900382-7900404 TCTCTGGGGTGAGGAAGTTCAGG - Exonic
1145283191 17:21483308-21483330 TCTCTAGGTTGAGGAGGCTGGGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145394291 17:22482492-22482514 TCTTTAGGTTGAGGAGGCTGGGG + Intergenic
1147262264 17:39215342-39215364 TCTCTGGGATGAGGAAGACCTGG - Intronic
1150315992 17:64169433-64169455 TGTCTAGGTTTGGGAATTTCTGG - Intronic
1152365600 17:79854607-79854629 TCTCTAGGTTGGGGAGGAGCTGG + Intergenic
1153717690 18:7867748-7867770 TTTCTAGGTTGGGGAAGTTCTGG + Intronic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1157006259 18:43588641-43588663 TTTCTAGGTAGAGGAATTACTGG + Intergenic
1157068249 18:44376425-44376447 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1157163587 18:45337492-45337514 TCAGTTGGTTGAGGAAGTTTAGG - Intronic
1159901932 18:74054849-74054871 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1161612132 19:5248983-5249005 TCTCTACCTTAAGGGAGTTCAGG + Intronic
1161634582 19:5379588-5379610 TCTCTAGGATGAGGGAATTTTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163450880 19:17376835-17376857 TCTCTTGGATGAGGAAACTCAGG + Intronic
1164047333 19:21553910-21553932 TTTCTAGGTTGGGGAACTTCTGG + Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165153590 19:33774574-33774596 TCTCCAGGTAGAGGAACTGCTGG + Intergenic
1166073158 19:40398229-40398251 TCTCTAGAATGAGGATGTTGGGG - Intronic
1166312493 19:41970516-41970538 TCTTTAGGTTGTCGAAGATCAGG + Exonic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
928480889 2:31682575-31682597 TTGCTAGGTTAGGGAAGTTCTGG + Intergenic
929333362 2:40711475-40711497 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
930216850 2:48706444-48706466 TTGCTAGGTTGGGGAAGTTCTGG + Intronic
933052214 2:77613551-77613573 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
936448169 2:112613536-112613558 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
937094874 2:119228813-119228835 TCTCAAGGCTGAGGGAGCTCAGG + Intronic
937526279 2:122773649-122773671 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
938224128 2:129601124-129601146 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
938651395 2:133387596-133387618 TTGCTAAGTTGGGGAAGTTCGGG + Intronic
938880151 2:135577617-135577639 TCTCGAGGTTGAGAAACCTCAGG - Intronic
940592744 2:155749833-155749855 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
942395182 2:175539564-175539586 TCTCTAGAATAAGGAAGTACAGG + Intergenic
942522751 2:176821438-176821460 TCTCTAGGTTGTGGAGGTGCAGG + Intergenic
942669030 2:178353684-178353706 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
942936211 2:181559747-181559769 TCTCTAAGTTTAGGAAGCTCTGG + Intronic
943038322 2:182773382-182773404 TTGATAGGTTGAGGAAGTTCTGG + Intronic
945490307 2:210446937-210446959 TGTGAAGGTTGGGGAAGTTCTGG - Intronic
945595378 2:211784196-211784218 GCTCAAGGTTGAAAAAGTTCTGG - Intronic
945714255 2:213337813-213337835 TTGCTAGGTTGAGGAAATTCTGG - Intronic
945824644 2:214706326-214706348 GCTGTAGGTTTTGGAAGTTCTGG - Intergenic
946065157 2:216981258-216981280 TTGCTAGGTTGTGGAAGTTCTGG + Intergenic
947681254 2:232036071-232036093 TTGCTAGGTTGGGGAAGTTCTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1169012964 20:2266039-2266061 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1170266226 20:14469478-14469500 TAGCTAGGTTGGGGAAGTTCTGG + Intronic
1173536801 20:43821047-43821069 TCTCTGGGTTGAGGAAGAGAGGG - Intergenic
1174590223 20:51639390-51639412 TCTGTAGGATGGTGAAGTTCAGG + Exonic
1175960433 20:62633754-62633776 GCTCTAAGATGAGTAAGTTCTGG + Intergenic
1176743821 21:10632658-10632680 TTTCTAGATTGGGGAAGTTCTGG - Intergenic
1177636857 21:23798379-23798401 TCTCTAGGTTCAGGAAATTTAGG + Intergenic
1178203857 21:30440637-30440659 TCTCTTGGTTGTGGAAGCACTGG + Exonic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179458332 21:41515167-41515189 TTCCTAGGTAGAGGCAGTTCTGG + Intronic
1179466535 21:41579404-41579426 TTTCTTGTTTGAGGATGTTCAGG - Intergenic
1180504792 22:15984643-15984665 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
1182998605 22:34836560-34836582 GCTCTTGGAGGAGGAAGTTCTGG - Intergenic
1184886613 22:47350101-47350123 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
949308574 3:2671143-2671165 TTGCTAGATTGGGGAAGTTCTGG + Intronic
949874082 3:8612956-8612978 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
949888939 3:8717528-8717550 TTGCTAGATTGGGGAAGTTCTGG - Intronic
950772599 3:15324143-15324165 TCTGCAGGTTGAGGAAGGTTGGG - Intronic
950925073 3:16732257-16732279 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
951175549 3:19594813-19594835 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
951251904 3:20403792-20403814 CCTCTAGATCCAGGAAGTTCAGG + Intergenic
955302053 3:57789521-57789543 TGTCGAGGTTGAGGGGGTTCTGG + Intronic
956243575 3:67155871-67155893 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
958431118 3:94042778-94042800 TCTCTAGATTGTGGAATTACTGG + Intronic
958520767 3:95183302-95183324 TTGCTAGGTTGGTGAAGTTCTGG + Intergenic
959578842 3:107963740-107963762 TAACTCGGTTGAGGAAGTGCTGG - Intergenic
960316228 3:116180584-116180606 TTTCAAGGTTGAGGAAGTAGAGG + Intronic
960661893 3:120069328-120069350 TCTCAATTTTGAGGAAGTTGGGG - Intronic
962984306 3:140520712-140520734 TTGCTAGGTTTGGGAAGTTCTGG + Intronic
964053257 3:152421207-152421229 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
964232651 3:154488389-154488411 TTGGTAGGTTGGGGAAGTTCTGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966395737 3:179501046-179501068 TCTCTCAGTTGAGTAAGCTCTGG + Intergenic
967431589 3:189392001-189392023 TCTCTAAGTTGAGGAAGCCTTGG + Intergenic
967569757 3:191015092-191015114 TCACTAGGTTGGGGAAGTTCTGG + Intergenic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
969081298 4:4620644-4620666 TGTCTAAGTTGAGAGAGTTCTGG - Intergenic
970292294 4:14586428-14586450 TATCAAGCTTGAGGAAATTCAGG + Intergenic
972330836 4:38063304-38063326 TCTCAAGGTCCTGGAAGTTCAGG - Intronic
973137609 4:46727167-46727189 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
973544963 4:51972278-51972300 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
973966264 4:56165080-56165102 TCACTGTGTTAAGGAAGTTCAGG + Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975520846 4:75299528-75299550 CTTCTAGGTTAAGGAAGTTCTGG + Intergenic
977154637 4:93556688-93556710 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
978418568 4:108504704-108504726 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
978699602 4:111627001-111627023 TTGCTAGGTTAAGGAAGTTCTGG + Intergenic
979948682 4:126865408-126865430 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
982792904 4:159613969-159613991 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
983050801 4:163045183-163045205 TCTCTTGGCTGAAGAAGATCAGG - Intergenic
984177206 4:176434236-176434258 TCTCTAAGTTGTGGAAGCACGGG - Intergenic
986011735 5:3723275-3723297 TTGTTAGGTTGGGGAAGTTCTGG + Intergenic
987450926 5:18083280-18083302 TCTCAAGGTTGTGCAAGTACAGG + Intergenic
987540490 5:19248267-19248289 TCTCTAGGTATAGGAAGCTGTGG - Intergenic
987983506 5:25118287-25118309 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
989087410 5:37690300-37690322 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
989470208 5:41807423-41807445 TGTCTAGGTTGAAGAAATTGTGG - Exonic
989682452 5:44045628-44045650 TTGCTAGGTTAAGCAAGTTCTGG + Intergenic
991026501 5:62036210-62036232 TTGCCAGGTTGGGGAAGTTCTGG + Intergenic
991053078 5:62293115-62293137 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
993484975 5:88472788-88472810 TCTCTAGATTGAGGGATGTCAGG - Intergenic
993915921 5:93742277-93742299 TCTGTTGGTTGAGGAAACTCTGG - Intronic
995578888 5:113573519-113573541 TTGCTAGGTTAGGGAAGTTCTGG + Intronic
997217686 5:132127960-132127982 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
998780622 5:145652341-145652363 TTGCTAGGTTGTGGAAGTTCTGG - Intronic
999316320 5:150586219-150586241 TCTCTAGGGTGAGGCAGCTGAGG + Intergenic
1002539643 5:179897885-179897907 TGTCCAGGCTTAGGAAGTTCTGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003232132 6:4263840-4263862 ACTCCAGGTTGATGAAGTTATGG + Intergenic
1003782545 6:9445308-9445330 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1006643275 6:35499150-35499172 CCACTAGGGTGAGGAAGTTTGGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007560383 6:42803078-42803100 TGTCTAAGTTGAAGAATTTCTGG - Intronic
1008193622 6:48491385-48491407 TCCCTAGGTAAAGCAAGTTCAGG - Intergenic
1008769349 6:54960638-54960660 TCTCTAGGTAAAGGCAGTGCTGG + Intergenic
1008969736 6:57353329-57353351 TCTCTGGGTAGAGGTTGTTCAGG + Intronic
1009158701 6:60255154-60255176 TCTCTAGGTAGAGGTTGTTCAGG + Intergenic
1009458925 6:63889228-63889250 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
1010476781 6:76298089-76298111 TTGCTAGGTTTGGGAAGTTCTGG + Intergenic
1010851692 6:80784604-80784626 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
1011288752 6:85753225-85753247 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1011525056 6:88255203-88255225 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1011848133 6:91591556-91591578 TTTATAGGTTGAGGAATTTCTGG - Intergenic
1014871189 6:126598375-126598397 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
1014907255 6:127044835-127044857 TTGCTAGGTTCAGGAAATTCTGG - Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1019849340 7:3538738-3538760 ACTCCAGGTTCATGAAGTTCTGG - Intronic
1021632131 7:22657846-22657868 TCTTTAGGCTCAGGAAGTTTGGG - Intergenic
1023108337 7:36785291-36785313 CCTTTAGGTTGAAGGAGTTCAGG - Intergenic
1023248572 7:38233230-38233252 TCTCTACATTGCTGAAGTTCGGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024664738 7:51535304-51535326 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1025788044 7:64661476-64661498 TTGCTAGGTTGAGGAAGTTCTGG - Intergenic
1027443778 7:78247980-78248002 TCTCTAGGTTGAGTTTGTTTGGG - Intronic
1027982553 7:85244559-85244581 TCTCTAGGTTGCGATAGTCCAGG + Intergenic
1028049070 7:86159729-86159751 TTGGTAGGTTGGGGAAGTTCTGG - Intergenic
1028562203 7:92188290-92188312 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
1028600965 7:92599958-92599980 TCTCCAGGTTGTGGAGTTTCAGG + Intergenic
1030750949 7:113232109-113232131 TCTCTAGGTAGTGGAGTTTCAGG - Intergenic
1031617285 7:123896076-123896098 TTGCTAGATTGGGGAAGTTCTGG - Intergenic
1031858259 7:126947916-126947938 TCTCAAGGGTGAGGAAGCTAAGG + Intronic
1032367889 7:131317046-131317068 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
1032708112 7:134439727-134439749 TTTGTAGGTTGAGGAAATTAAGG + Intergenic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1032966597 7:137104919-137104941 TTCCTAGGTCGGGGAAGTTCTGG - Intergenic
1034197484 7:149259536-149259558 TCTCTTGGCTGAGGATGTTCTGG + Intergenic
1034375400 7:150639180-150639202 TTGCTAGGTTGGGGATGTTCTGG + Intergenic
1035115745 7:156522560-156522582 TCTCTGGGTTGGTGAAGTACTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039636955 8:39178066-39178088 TTGCTAGGTTGAGGAAGTTCTGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041595807 8:59650118-59650140 TATCTAGGTAGATGAATTTCAGG + Intergenic
1041842896 8:62292784-62292806 TCACTAGGTTGGGGAAGTTGTGG + Intronic
1042877755 8:73455460-73455482 TCTCTAGGTCAAGGGAGGTCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043498066 8:80824515-80824537 TTGCTAGGTTGGGGAAGTTCTGG - Intronic
1044242633 8:89904076-89904098 TCTCTAGGTTGTGGATATTAAGG + Intronic
1044609532 8:94078441-94078463 TCTCCAGGTTGATGCAGCTCTGG - Intergenic
1045185004 8:99829150-99829172 TTGCTGGGTTGGGGAAGTTCTGG + Intronic
1045827094 8:106411216-106411238 TCTCTAGTTTGGGAAAGTCCTGG + Intronic
1048565523 8:135592817-135592839 TCTCTAGGGAGAGCAAATTCTGG + Intronic
1050404640 9:5294583-5294605 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1050963478 9:11767150-11767172 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1052761992 9:32602114-32602136 TCTTTAGGTTGAGTAATTTATGG - Intergenic
1054951680 9:70858916-70858938 TCTCCAGGATGGGGAAGGTCAGG + Intronic
1055018087 9:71640769-71640791 TCTCTGGGTTGTGGGAGTTCTGG - Intergenic
1059752971 9:117266099-117266121 GCTCAAGGATGAGGAAGTGCAGG - Intronic
1061694041 9:132357524-132357546 TCTATAGGTTGTGTAAGTTTTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188815144 X:34704224-34704246 TCTCTAGGTTTAGGAAGTTTAGG + Intergenic
1190529836 X:51363201-51363223 TTGCTAGGTTGGGGAAGTTCTGG - Intergenic
1191070757 X:56397618-56397640 TCTCTAGTTTGAGGAGGGTCTGG - Intergenic
1191071875 X:56409578-56409600 TTGCTAGGTTGGGGAAATTCTGG + Intergenic
1191225045 X:58033906-58033928 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1192703975 X:73509024-73509046 TCTTTAGGTTTAGGAGGGTCTGG + Intergenic
1192915894 X:75651007-75651029 TCACTATGCTGGGGAAGTTCTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195249011 X:103025014-103025036 TTGCTAGATTGGGGAAGTTCTGG + Intergenic
1195892170 X:109707923-109707945 TCTCTAGGTTGCAGAATTACAGG + Intronic
1196133561 X:112182756-112182778 TTGCTAGGTTGGGAAAGTTCTGG - Intergenic
1196467225 X:115984579-115984601 TTGCTAGGCTGGGGAAGTTCTGG - Intergenic
1198669563 X:139064723-139064745 TTACTAGGTTGGGGAAGTTCTGG + Intronic
1199539941 X:148947622-148947644 TCTCTAGCTAGAATAAGTTCAGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200732423 Y:6757218-6757240 TTGCTAGGTTGGGGAAGTTCTGG + Intergenic
1201572333 Y:15427499-15427521 TTGCTAGATTGTGGAAGTTCTGG - Intergenic
1201612014 Y:15853300-15853322 ATGCTAGGTTGGGGAAGTTCTGG - Intergenic
1201684427 Y:16684778-16684800 TTGCTAAGTTGGGGAAGTTCTGG - Intergenic