ID: 968693658

View in Genome Browser
Species Human (GRCh38)
Location 4:2009472-2009494
Sequence CGTGCAGGTGCTGGGCCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968693658_968693672 20 Left 968693658 4:2009472-2009494 CCCGCGGGCCCAGCACCTGCACG 0: 1
1: 0
2: 2
3: 29
4: 217
Right 968693672 4:2009515-2009537 GGAGCGAGCCTGCGGGATCCCGG 0: 1
1: 0
2: 1
3: 6
4: 123
968693658_968693669 13 Left 968693658 4:2009472-2009494 CCCGCGGGCCCAGCACCTGCACG 0: 1
1: 0
2: 2
3: 29
4: 217
Right 968693669 4:2009508-2009530 GCCCTGCGGAGCGAGCCTGCGGG 0: 1
1: 0
2: 2
3: 15
4: 210
968693658_968693666 -1 Left 968693658 4:2009472-2009494 CCCGCGGGCCCAGCACCTGCACG 0: 1
1: 0
2: 2
3: 29
4: 217
Right 968693666 4:2009494-2009516 GGAGAGGAGCCGCGGCCCTGCGG 0: 1
1: 0
2: 2
3: 25
4: 387
968693658_968693664 -9 Left 968693658 4:2009472-2009494 CCCGCGGGCCCAGCACCTGCACG 0: 1
1: 0
2: 2
3: 29
4: 217
Right 968693664 4:2009486-2009508 ACCTGCACGGAGAGGAGCCGCGG 0: 1
1: 0
2: 0
3: 21
4: 195
968693658_968693668 12 Left 968693658 4:2009472-2009494 CCCGCGGGCCCAGCACCTGCACG 0: 1
1: 0
2: 2
3: 29
4: 217
Right 968693668 4:2009507-2009529 GGCCCTGCGGAGCGAGCCTGCGG 0: 1
1: 0
2: 1
3: 24
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968693658 Original CRISPR CGTGCAGGTGCTGGGCCCGC GGG (reversed) Exonic
900081779 1:863997-864019 CTTGCAGGTGCTGTGCCCAAAGG + Intergenic
900544411 1:3220500-3220522 CTTGCAGGTGCAGGGGCCACAGG + Intronic
900582887 1:3417991-3418013 CGTGCAGGTGAGGGGCCCTTTGG + Exonic
901187634 1:7385491-7385513 TGTGCAAGTACTGGGCTCGCGGG + Intronic
901207620 1:7505879-7505901 CGTGCAGGTGAAGCGCCCACAGG - Intronic
902583709 1:17425510-17425532 CGTGCGGGTGCTGGGCACTGGGG - Intronic
905142140 1:35855890-35855912 AGTGCAGGTGTGGTGCCCGCTGG - Exonic
907387714 1:54136734-54136756 CACGCAGGCGCTGGCCCCGCTGG - Intronic
908247986 1:62243046-62243068 AGTGCAGGTAATGGGCCCACAGG - Intronic
910232106 1:84997482-84997504 CATGGAGGTGCTGGACCTGCCGG - Intergenic
912775147 1:112502153-112502175 CGCGCAGGTGCTGCGCCCGCGGG + Intronic
913972264 1:143424050-143424072 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
914066646 1:144249663-144249685 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
914112507 1:144716691-144716713 GGAGGAGGTGCTGTGCCCGCTGG - Intergenic
915041530 1:152971935-152971957 CTTGCTGCTGCTGGGCCCTCTGG - Exonic
915354537 1:155248165-155248187 TGGGCAGGTGCAGGGCCCGAGGG + Exonic
915490436 1:156247415-156247437 AGTGGAGGGGCTGGGCCAGCTGG + Intronic
916674393 1:167053918-167053940 CCTCCAGGTGCTGGGCACACAGG + Exonic
916792567 1:168136882-168136904 CGTGCTGGTGGCTGGCCCGCGGG - Intronic
917797604 1:178543015-178543037 CGTGCAGATGCTGGGCCGGGAGG + Intronic
919704482 1:200663247-200663269 GGTGCAGGAGCTGGGTCCTCGGG - Intronic
919739059 1:200971739-200971761 CCTGCTGGTGCTGGCCCTGCTGG - Intronic
919784471 1:201250617-201250639 GGTGGAGGTGCAGGGCCAGCTGG + Intergenic
922230237 1:223679485-223679507 CGTTCTGGTGCTGAGCCTGCTGG - Intergenic
922775449 1:228212409-228212431 CGTGGAGGTCCCGGGCCGGCTGG - Exonic
1064381235 10:14843470-14843492 GGTGCAGGGGCTGGGCTCCCCGG - Intronic
1067031331 10:42880132-42880154 AATGCAGGTGCTGGGCCCCGCGG + Intergenic
1067116247 10:43437322-43437344 CGAGCGGGGACTGGGCCCGCTGG + Intronic
1069743974 10:70703259-70703281 AGTGCTGGTCCTAGGCCCGCTGG + Intronic
1069823344 10:71240635-71240657 CGGGCAGCTGCTGGGCCGGGAGG - Intronic
1070934628 10:80283702-80283724 TGGGCATGTGCTGGGCCCACTGG + Intronic
1075344627 10:121673182-121673204 CGTTCATGTGCTGGCCCCTCGGG - Intergenic
1076313085 10:129521945-129521967 CGTGCCGGTGCAGGGCACGCAGG + Intronic
1076824903 10:132961992-132962014 CGTGCATGTGCCAGGCCGGCAGG + Intergenic
1076876472 10:133218648-133218670 CGTGGAGGGGCTGGGCTGGCGGG - Intronic
1080839014 11:35967137-35967159 CCTGCAGGGACTGGGCCTGCTGG + Intronic
1081770823 11:45649774-45649796 CCAGCAGGTGCTGGCCCAGCTGG - Exonic
1082075618 11:47973883-47973905 CATGCAGGTACTGGGCTCACTGG + Intergenic
1083811653 11:65109917-65109939 CGTGCAGGTGCTGCCCAGGCTGG + Exonic
1083945832 11:65922066-65922088 CTTGCAAGTGCTGGGCATGCGGG + Intergenic
1084092238 11:66886231-66886253 GGTCCAGGTGCTGGGGCGGCTGG + Intronic
1084271233 11:68030391-68030413 GGTGCAGAGGGTGGGCCCGCCGG - Intergenic
1084285556 11:68128475-68128497 CGGGCAGGGGCGGGGCCCGCGGG + Intergenic
1084700779 11:70785072-70785094 CCTGCAGCTGCTAGGCCCGTAGG + Intronic
1084966182 11:72745877-72745899 AGTGCAGCTGCTGTGCCCACAGG + Intronic
1089215742 11:116833651-116833673 CGTGCAGGTGCTGTGCCAAACGG - Intergenic
1089907990 11:122065252-122065274 AGTGGAGGTGCTGGGCACCCAGG - Intergenic
1096215228 12:49794814-49794836 GGGGCAGGTGCAGGGCCAGCTGG - Exonic
1096878930 12:54651655-54651677 CTTCCAGGGGCTGGGCCCACTGG - Intergenic
1099890213 12:88580658-88580680 AGTGCAGGTCCGGGGCCCCCAGG - Intronic
1108585389 13:51866085-51866107 CATGCAGGTGCAGGGCCCTGTGG + Exonic
1110730644 13:78876019-78876041 AGTACAGGTGCTGGCCCCGTGGG + Intergenic
1112179836 13:97068015-97068037 CGGCCAGGTGCTGGGCCAACAGG - Intergenic
1113429793 13:110240295-110240317 CCTGGAGGTGCTGGGCTCCCTGG + Intronic
1113522247 13:110949337-110949359 CGTGCAGCAGGTGGGACCGCAGG - Intergenic
1113608867 13:111629213-111629235 GGTGCCGCTGCTGAGCCCGCAGG + Intronic
1115063715 14:29227260-29227282 CTTGCAGGGGCTGGGCGCGGTGG - Intergenic
1117647341 14:57865891-57865913 GGTGCAGGTGCCGGAGCCGCTGG + Intronic
1119348641 14:73946293-73946315 GGTGCAGGTCCAGTGCCCGCAGG - Exonic
1122119185 14:99542781-99542803 CATGCAGCTGCAGGACCCGCTGG - Intronic
1122125324 14:99575657-99575679 CCTGCATGTGCTGGGCCTGCAGG + Intronic
1122309249 14:100784142-100784164 CGGGCAGGTGGTGGCCCCTCTGG + Intergenic
1122792129 14:104188460-104188482 TGTGCTGGTGCAGGGCTCGCTGG + Intergenic
1122866074 14:104604537-104604559 GGTGCAGGAGTGGGGCCCGCCGG - Exonic
1124652424 15:31483734-31483756 CGTGCAGGCGTCGGGCGCGCGGG - Exonic
1128654880 15:69453186-69453208 CGGGCAGGTCCTGGGCCCCCGGG + Intronic
1129316779 15:74749990-74750012 CGTGCTGGTGCTGAGCCGCCTGG + Exonic
1130002577 15:80059957-80059979 GCAGCAGGTGGTGGGCCCGCGGG + Intronic
1132414941 15:101613092-101613114 TGTGCAGGGGCTGGGGCTGCTGG + Intergenic
1132568225 16:632848-632870 TGTGGAGGTGCAGGCCCCGCAGG - Exonic
1132750878 16:1457088-1457110 CGGGCAGGGACTGTGCCCGCTGG + Intronic
1133222531 16:4324955-4324977 CGGGCAGGGGCAGGGCCTGCTGG - Intronic
1133255862 16:4515214-4515236 CCTGCAGGTGCTGGGCTGTCTGG - Intronic
1133719601 16:8482718-8482740 TGTGCTGGTGCTGGGCGCGGTGG - Intergenic
1136364962 16:29805777-29805799 GGCGCAGGTGGTGGGCGCGCGGG - Intergenic
1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG + Intergenic
1138554111 16:57762222-57762244 AGAGCAGCTGCAGGGCCCGCTGG + Exonic
1139648793 16:68351394-68351416 CCTGCAGGTGCTGGGGACGGAGG - Intronic
1140826886 16:78715307-78715329 TGTGCAGTTGCTGAGCCGGCTGG - Intronic
1141458469 16:84161218-84161240 CGAGCAGGTGCTGGGCTCCTAGG + Intronic
1142151415 16:88514236-88514258 CGGGCAGGTGCTGGGTCCCAGGG - Intronic
1203079453 16_KI270728v1_random:1139645-1139667 CGTGAGGGTGGTGGGCCTGCGGG - Intergenic
1142763695 17:2054939-2054961 CGCACAGATGCTGAGCCCGCGGG - Intronic
1142809565 17:2388973-2388995 TGTCCAGGTGCAGGGCCCGCAGG + Intronic
1143512842 17:7405491-7405513 CGGGCGGGGGCTGGGCCTGCGGG + Intronic
1144775305 17:17782155-17782177 CGCGCAGGGGCGGGGGCCGCGGG + Intronic
1146890581 17:36504005-36504027 CTTGCAGGTCCTGAGCCAGCTGG - Exonic
1147375371 17:40019739-40019761 CCTGCTGGTGCTGGGGCCTCGGG - Intronic
1147422199 17:40327427-40327449 GGTGCATGGGCTGGGCCCACAGG + Intronic
1147705581 17:42422923-42422945 CGTGCTGGTGCTGAGCCTCCTGG - Exonic
1148502991 17:48106169-48106191 CTTGGAGCTGCTGGGACCGCAGG - Intronic
1149378805 17:56071934-56071956 AGTGCATGTTCTGGGCCCTCCGG + Intergenic
1150123148 17:62619766-62619788 GGTGGAGGTGGTGGGCCAGCTGG + Intergenic
1150782563 17:68134902-68134924 CGTGCAGATCCTGGACCAGCTGG - Intergenic
1150798426 17:68259195-68259217 TTCGCAGCTGCTGGGCCCGCCGG - Exonic
1151574703 17:74946872-74946894 CGGGCCGCTGCTGGGCCTGCTGG + Exonic
1151575861 17:74952291-74952313 GCTGCAGGTGCTGGTTCCGCAGG - Exonic
1151662524 17:75526166-75526188 CGTGCAGGCGCCAGGCCAGCGGG + Intronic
1151704025 17:75757426-75757448 CCTCCAGGTGCTGGGCCCCCAGG - Exonic
1152062318 17:78086903-78086925 CGAGCAGGGCCTGGGCCAGCTGG - Exonic
1152662023 17:81546975-81546997 GGGGCAGGTACTCGGCCCGCAGG + Exonic
1154388996 18:13920441-13920463 CATGCAGGTGCTGGGGATGCAGG + Intergenic
1154502482 18:15003704-15003726 CCTGCAGGTGCTGGGCCTCCAGG - Intergenic
1157383921 18:47247047-47247069 GGTGCGGGTGCTGGGCCAGAGGG + Intronic
1160580916 18:79884262-79884284 GGTGCAGGTGTGGGGCCCACAGG - Intronic
1160985489 19:1836772-1836794 GGAGCAGGGGCTGGGCCTGCCGG - Intronic
1161069709 19:2253938-2253960 CGTGCAGCTGCGGGGCACCCGGG - Intronic
1161241823 19:3227180-3227202 CCTGCAGGTGCTTGGCACGAAGG + Intronic
1161574126 19:5046475-5046497 CGTGCAGGTGCAGGAACAGCTGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1161953585 19:7480829-7480851 CCAGCAGGAGCTGGGCCCCCTGG - Intronic
1162066176 19:8126636-8126658 GGTGCAGGTGTAGGGCCGGCAGG - Intronic
1162373697 19:10293131-10293153 CGTGCTGGCTCTGGGCCTGCTGG + Exonic
1162810235 19:13159957-13159979 TCTGCAGGAGCTGGGACCGCAGG + Intergenic
1162904969 19:13817936-13817958 GGTGCAGGTGCTGCGCAAGCAGG + Exonic
1163313826 19:16529674-16529696 GGGGCAGGTGCTGGGGCCGGGGG + Exonic
1163653724 19:18533332-18533354 CTTACAGGTGCTGGCCCAGCAGG - Exonic
1165074204 19:33271853-33271875 CGAGCAGCTGCTGGGCCCTGAGG - Intergenic
1165233832 19:34404717-34404739 CGTGCAGGTGTATTGCCCGCTGG + Exonic
1165433838 19:35786466-35786488 CCAGCAGGTGCTGGGCCCACAGG - Intronic
1165460189 19:35939749-35939771 CATCCAGGTGCAGGGCACGCAGG - Exonic
1165923843 19:39314973-39314995 TGTCCAGGTGCAGGGCCCGGAGG + Exonic
1166874595 19:45889974-45889996 GGTGTAGGTGCTGGTCCCCCAGG + Intergenic
1167429814 19:49447800-49447822 GGGGCAGGTCCTGGGCCCTCGGG - Intronic
1167431860 19:49459766-49459788 GGAGCAGCTGCTGGGCCAGCTGG - Exonic
1168401507 19:56088256-56088278 CGTCCCCGTGCTGGGCCCGCTGG + Exonic
925159764 2:1675909-1675931 AGTGCTGGGGCTGGGCCGGCAGG + Intronic
925235346 2:2272866-2272888 CCTGGAGGTGCAGGGCCAGCAGG - Intronic
926190876 2:10726712-10726734 CCTGCGGGTGCTGGGTCTGCAGG + Intronic
928100068 2:28431782-28431804 GGTGGGGGTGCTGGGCCCGCTGG - Intergenic
931321335 2:61177291-61177313 CGGGGAGGGGCTGGGGCCGCCGG - Intergenic
932667324 2:73708154-73708176 CGTGCAGGCTCTTGGCCCACTGG + Intergenic
933092456 2:78137908-78137930 CTTGTAGGTGTTGGGCCTGCAGG + Intergenic
934176957 2:89584987-89585009 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
934287264 2:91659347-91659369 GGAGGAGGTGCTGTGCCCGCTGG + Intergenic
934675771 2:96248757-96248779 CCTGAAGGTGCAGGGCCTGCAGG - Exonic
935336692 2:102023239-102023261 TGTGCAGTTGCTGGGACTGCTGG + Intronic
938501662 2:131833876-131833898 CCTGCAGGTGCTGGGCCTCCAGG - Intergenic
944381350 2:199114398-199114420 CGTGCAGGTACTGTGCTCTCTGG + Intergenic
946050254 2:216856190-216856212 CTTGCAGGTGCTGGGCCTACAGG + Intergenic
948663315 2:239519915-239519937 CATGAAGGTGCTGGGGCTGCAGG + Intergenic
948698826 2:239748029-239748051 CGTGCAGGTGAGGGGCAGGCAGG - Intergenic
948807335 2:240458733-240458755 CTTGCAGCTGCTGGGACAGCAGG + Intronic
1169832466 20:9839191-9839213 CGTGCAGGAGCTGCCCCCGCCGG - Intergenic
1172118704 20:32585474-32585496 CGGGCGGGGGCTGGGCCCGGCGG - Intronic
1174507036 20:51023438-51023460 CGTGCAGGCGAAGGGGCCGCAGG - Intergenic
1174806455 20:53608124-53608146 CGGGCAGGTTCTGCGGCCGCGGG - Intronic
1175894293 20:62329279-62329301 GCTGCAGGCTCTGGGCCCGCGGG - Intronic
1175948295 20:62568933-62568955 AGGGCAGGTGCGGGGCCAGCAGG - Intronic
1176844984 21:13869789-13869811 GGTGCAGGAGCTGGGGCAGCCGG + Intergenic
1177366925 21:20151518-20151540 AGTGCAGGAGCTGGGCACCCAGG + Intergenic
1179129514 21:38622059-38622081 CGTGCATGTCCTGGGACAGCTGG - Intronic
1179501761 21:41813529-41813551 CGTGCAGTTGAGGGGCCCCCAGG + Intronic
1179628214 21:42660335-42660357 GGAGCAGGTGCGGGGCCTGCAGG + Intronic
1179839586 21:44062643-44062665 GGTGCAGGGGCTGGGCCAGCGGG + Intronic
1179839603 21:44062709-44062731 GGTGCAGGGGCTGGGCTGGCAGG + Intronic
1179949608 21:44702377-44702399 CGTGCAGGAGCTGGGCTCACAGG - Intronic
1180474277 22:15688637-15688659 CAGGCAGGTGCTGGGCTCGGTGG + Intergenic
1180842129 22:18964368-18964390 TGTGCAGGGCCTGGGCCTGCAGG - Intergenic
1181049752 22:20232929-20232951 CCTGCAGGTGTTGGGGCCACAGG - Intergenic
1181162029 22:20965073-20965095 CGGGGCGGTGCTGGGCCCGCGGG + Intergenic
1181324597 22:22034877-22034899 GGTGCAGGTGCTGGACCCTCAGG - Intergenic
1181458326 22:23071697-23071719 AGTGCAGGTGCAGGGGCCTCGGG + Intronic
1181652975 22:24271081-24271103 GGCGCAGGCGCTGGGCCTGCCGG - Intronic
1183189363 22:36311949-36311971 CGGGCAGCTGCTGGGGACGCAGG - Intronic
1184835598 22:47019216-47019238 CGAGCAGGTGCTGGGACCGCTGG - Intronic
1185085641 22:48739545-48739567 CATGCAGGTGCTGTGTCCTCTGG + Intronic
964246209 3:154656863-154656885 TGTGCAGGTGCTGCACCCTCAGG + Intergenic
968548140 4:1208919-1208941 GGGGCAGGGGCAGGGCCCGCTGG - Exonic
968693658 4:2009472-2009494 CGTGCAGGTGCTGGGCCCGCGGG - Exonic
968971493 4:3797995-3798017 CGTGCAGGGGCTGGGGGCACTGG + Intergenic
969235811 4:5864550-5864572 CCTACAGGTGCTGGGCCCCAGGG + Intronic
969493477 4:7512879-7512901 CATGGAGGGGCAGGGCCCGCAGG - Intronic
969574583 4:8029640-8029662 CGTCCAGGTACTTGGCCCCCTGG - Exonic
980930343 4:139177676-139177698 CGTGCACCTGCAGCGCCCGCCGG + Intergenic
984481697 4:180311843-180311865 CCTGCATGTGCAGGGCCCTCAGG + Intergenic
984754478 4:183313009-183313031 GGGGCAGGTGCTGGGGCTGCGGG + Intronic
984823707 4:183906199-183906221 CGTGCGGCTGATAGGCCCGCGGG + Exonic
985048820 4:185969909-185969931 CCTGCAGGTGCTGGAGCAGCTGG - Intergenic
985654603 5:1123370-1123392 CTTGCAGGTGCTGGGACCCAAGG - Intergenic
985694101 5:1330300-1330322 CCTGCTGGTGCTGGTCCCGGCGG - Exonic
985725396 5:1513404-1513426 CTTGCAGGAGCTGAGCCCTCGGG - Intronic
986826301 5:11526493-11526515 CTTCCAGGTGCTGGCCCAGCTGG + Intronic
987234215 5:15927375-15927397 CGTGCATGTGCTTGGTCCTCTGG + Intronic
988081026 5:26415968-26415990 CCTGAAGGTGCTGTGCCTGCTGG + Intergenic
988260603 5:28882273-28882295 AGTGCAGGAGCTGGGCACCCTGG + Intergenic
990210545 5:53478918-53478940 GGTGCAGGTGCGGCGGCCGCGGG + Intergenic
990417965 5:55604951-55604973 CCGGGAGGTGCTGGGCCCGGTGG + Intergenic
997210436 5:132073882-132073904 CGTGCTGGGGCTGGGCGAGCGGG - Exonic
997283851 5:132664752-132664774 GGTGCTGGTGCTGGTCCAGCCGG - Intergenic
999176558 5:149635857-149635879 GGTGCAGGTGCTGGGCCTTGTGG + Intergenic
1000363309 5:160467985-160468007 CGTGCAGGGTCTGGACCCCCGGG - Intergenic
1004229024 6:13814384-13814406 CGGGCAGGCGCTGGGTCCTCTGG + Exonic
1006094523 6:31647609-31647631 GGGGCAGGTGTTGGGCCCGCTGG + Exonic
1006749738 6:36369404-36369426 AGGGCAGGTGCTGGGCCCACAGG + Intronic
1007329072 6:41089626-41089648 TGTGCAGGTGCAGGGCCAGCAGG + Exonic
1010204985 6:73314744-73314766 CGAGCAGGCACTGGGCCCGGCGG + Intergenic
1010588749 6:77687565-77687587 GTTGCAGGTACTGGGCCCGTAGG + Intergenic
1017725501 6:157273872-157273894 GGTATAGGAGCTGGGCCCGCTGG - Intergenic
1017870101 6:158479852-158479874 CCTGCAGCTGCTGTGCCAGCAGG + Exonic
1018217133 6:161539392-161539414 CATGCAGGTGGTGGTCCGGCTGG - Intronic
1019013356 6:168861020-168861042 CGGGCAGGTCCTGGGCACACTGG - Intergenic
1019104747 6:169659192-169659214 CCTGCAGGTGCTGTGCTTGCTGG - Exonic
1019279185 7:191929-191951 CCTCCAGGCGCCGGGCCCGCTGG - Intergenic
1019486336 7:1291087-1291109 CCTGCAGGTCCTGGGCCCGGGGG - Intergenic
1019524395 7:1474251-1474273 CCTGCACGTGCTGGGCCTGCTGG - Exonic
1019596602 7:1861222-1861244 AGGGCAGGTGCTGGGTCCGGTGG + Intronic
1022095702 7:27139712-27139734 CGCGCAATTGCTGGGCCGGCCGG - Intronic
1022486723 7:30784649-30784671 CGTGCTGGGGCTGGGCCTTCTGG + Intronic
1023838688 7:44082998-44083020 CGTGTCGGTCCTGCGCCCGCCGG - Intergenic
1024531769 7:50399772-50399794 TGTGCAGGTGTGGGGTCCGCAGG + Intronic
1026045677 7:66904099-66904121 GAGGCAGGAGCTGGGCCCGCGGG - Intergenic
1031972442 7:128074434-128074456 TGTGCAGGGGCTGTGCCCGTGGG - Intronic
1032096371 7:128940282-128940304 CGTGCAGGCGCTGGTGCCGTTGG - Intronic
1034459743 7:151191820-151191842 TGTCCAGGTGCTGGGTCGGCTGG + Exonic
1035287422 7:157815197-157815219 TGGGCAGGCGCTGGGCACGCTGG + Intronic
1036690285 8:10940795-10940817 TTTGCTGGTGATGGGCCCGCCGG - Intronic
1037813364 8:22099337-22099359 CGTGCAGGAGCTGGGGCTGCAGG - Exonic
1037986421 8:23293385-23293407 CGAGCAAGGGCTGGGCCCACTGG - Intronic
1040355878 8:46617695-46617717 CGTGCAGAGGCGGGGCTCGCGGG + Intergenic
1048706016 8:137154640-137154662 GCTGCAGGTGCAGGGCCCTCAGG + Intergenic
1049357410 8:142195639-142195661 CCTGCAGATGCTGTGCCAGCTGG - Intergenic
1049451944 8:142666690-142666712 CGTGCAGGGGCTGGGCAGGCTGG - Intronic
1049594586 8:143477533-143477555 CATGCACCTGCTGGGCCTGCAGG - Intronic
1049719366 8:144108525-144108547 GGTGACCGTGCTGGGCCCGCTGG + Exonic
1049767061 8:144359741-144359763 GGTGCAGGTGCTGGGCATGGTGG + Exonic
1049814722 8:144592844-144592866 CGTACAGCTGCTGGCCCCGCAGG + Intronic
1051508183 9:17848015-17848037 AGTGCAGGTGCAGGGCCTGTGGG + Intergenic
1052610957 9:30773549-30773571 TATGCAGGTGCTGGGGCCACTGG + Intergenic
1052923161 9:33989486-33989508 CGTGCATGTGCCGGGCGCGGTGG - Intronic
1057075760 9:92137417-92137439 CATGTAGGTGCTGGGGCCACAGG + Intergenic
1057171109 9:92963759-92963781 GGGGCAGGTGCTGGGCCTGCTGG + Intronic
1057804172 9:98208876-98208898 TGTGCAGGTGCTGGACACGGAGG + Exonic
1058431708 9:104926650-104926672 GGTGGGGGTGCTGGGCGCGCGGG - Intronic
1058811692 9:108645735-108645757 CGTGCAGCAGCGGGGCTCGCAGG + Intergenic
1059320423 9:113464276-113464298 CGGACAGGTGCTGGGCCCTTTGG + Intronic
1060404465 9:123366374-123366396 CGTGCAGGTGCGCGGCCTGGCGG + Intronic
1060991241 9:127850401-127850423 TGTGTTGGTGCTGGGCCCTCGGG - Intronic
1060996550 9:127877526-127877548 CGTGCTGGTGCGGGGCTCCCTGG - Intronic
1061038653 9:128127459-128127481 CGTGGAGGTCCTGGGCGCGCAGG + Exonic
1061540650 9:131276624-131276646 GGTGCGGGTGCGGGGCCCGGAGG - Intergenic
1062498016 9:136840680-136840702 CCTGCAGGTGCTGGGCCTTCAGG + Exonic
1062509119 9:136895146-136895168 CTTGCCGGTCCTGGGCCTGCTGG + Intronic
1062519641 9:136952304-136952326 CTGGCAGCTGCTGGGCCCACAGG - Intronic
1062607248 9:137353778-137353800 CGTGCAGGAGCTCAGCCTGCTGG - Intronic
1062629827 9:137458724-137458746 CGGGCAGGGGCCGGGCCTGCAGG - Intronic
1190115462 X:47623720-47623742 GGTGCAGGTGCTCGGGCGGCAGG + Intergenic
1190278685 X:48915322-48915344 GGTGCAGGTGGTGGGCACCCTGG - Exonic
1197617815 X:128714611-128714633 TATGCAGGTGCTGGGGCCTCGGG + Intergenic