ID: 968694043

View in Genome Browser
Species Human (GRCh38)
Location 4:2012574-2012596
Sequence AGTATTGCATAACCTTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968694043 Original CRISPR AGTATTGCATAACCTTGATG TGG Intronic
909069222 1:70974314-70974336 AGTGTTCCTCAACCTTGATGTGG - Intronic
919316706 1:195979876-195979898 AGTATTGCAAAACTTTTATTAGG + Intergenic
920180377 1:204128813-204128835 AGTATTGCACAAAGTTCATGAGG + Intergenic
923840149 1:237661839-237661861 AGTAAGGCACAGCCTTGATGTGG + Intronic
923872836 1:238015182-238015204 AGTATTCTATGACCTAGATGTGG - Intergenic
1065653454 10:27919764-27919786 AGTATTGCATATCCTTGCATTGG - Intronic
1065738209 10:28772795-28772817 TGTATAGAATTACCTTGATGTGG + Intergenic
1069080883 10:64086941-64086963 TCTATAGCATAAGCTTGATGAGG + Intergenic
1069527924 10:69190193-69190215 AGTAGTGCTTAACTCTGATGGGG - Intronic
1070337003 10:75464728-75464750 AGTATTGTCTAACTTTGCTGGGG - Intronic
1070868577 10:79726863-79726885 AGTAATGCATGACCTTAATCAGG + Intergenic
1071635491 10:87249078-87249100 AGTAATGCATGACCTTAATCAGG + Intergenic
1071659749 10:87488896-87488918 AGTAATGCATGACCTTAATCAGG - Intergenic
1081403557 11:42669946-42669968 AGTTTTGCATAAAGATGATGAGG + Intergenic
1086015710 11:82164770-82164792 ACTATTCCATAAACTTGAGGAGG + Intergenic
1091580722 12:1787070-1787092 AGTTTTCCATATCCTTGCTGTGG + Exonic
1092887344 12:12936648-12936670 AGTATTCCATAGCCTGGGTGTGG + Intergenic
1094177480 12:27556097-27556119 AGTTTTGAGTAACCTTGTTGTGG + Intronic
1101455085 12:104823997-104824019 TGTATTTCATAACATTGATACGG + Intronic
1102090190 12:110180065-110180087 ACTATTCCTTAAGCTTGATGAGG - Intronic
1105271530 13:18880737-18880759 TTTATAGCATTACCTTGATGTGG - Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1111073881 13:83206559-83206581 AGTAATGCATAACCATGAATTGG + Intergenic
1116043372 14:39713486-39713508 AATAATCCATAAGCTTGATGGGG - Intergenic
1116906718 14:50411064-50411086 AGGATTTCACAACCTTGATATGG - Intronic
1119410147 14:74425561-74425583 AGTGTCGCAAAACCTTGGTGGGG + Intronic
1127521108 15:59743883-59743905 AGTAGTGAATTACTTTGATGTGG + Intergenic
1127743248 15:61935686-61935708 AGTATTGCATAAGCTTGATGAGG - Intronic
1128319813 15:66685260-66685282 AGTCCTGCAAAACCTGGATGGGG - Exonic
1131280140 15:91014390-91014412 TGTATCGCATATTCTTGATGCGG + Exonic
1131318899 15:91367652-91367674 AGTATAGTATAACATTTATGAGG + Intergenic
1133716437 16:8453980-8454002 AATATTGGATAACATTGAGGTGG + Intergenic
1140665045 16:77219688-77219710 AGAATTCCATCAGCTTGATGTGG - Intergenic
1150745958 17:67816854-67816876 AGTATTTCAAAATCATGATGAGG - Intergenic
1154945041 18:21154137-21154159 AGTATTCCAAAAACTTGAAGAGG - Intergenic
1158076363 18:53534849-53534871 ACTATTGCATAACGTTCACGTGG + Exonic
930529074 2:52569350-52569372 AGTATTTCACAACATTGAGGAGG - Intergenic
932977503 2:76621732-76621754 AGTATTCCAAAACATTGAGGAGG - Intergenic
933884292 2:86703519-86703541 ATTATTGGATAACCATGATCGGG + Intronic
937475652 2:122212887-122212909 AGCATTCCATAACCTTAAAGAGG - Intergenic
940491231 2:154363756-154363778 ACAATTGCATAAACATGATGTGG - Intronic
941799110 2:169635303-169635325 AGTACTACATAACATTGATGAGG - Intronic
945768839 2:214015002-214015024 AATATTTCATAAGCTTGAGGAGG + Intronic
1169251042 20:4061270-4061292 ATTATTTCATAACCTTGAGAAGG - Intergenic
1174567341 20:51475055-51475077 AGAATTGCTTGAACTTGATGCGG - Intronic
1175265252 20:57699185-57699207 AGGCTTGCACATCCTTGATGTGG - Intronic
1177422594 21:20879878-20879900 AGTATTGCATATGATGGATGTGG - Intergenic
1180722030 22:17916559-17916581 AGTCATTCATGACCTTGATGAGG - Intronic
949758854 3:7445766-7445788 AGAAATGCATACCCTTGAGGGGG + Intronic
952606844 3:35158029-35158051 AGTAGTGCAAAAACTTGCTGGGG - Intergenic
956001920 3:64738794-64738816 AGCCTTGCATTACCTTCATGAGG + Intergenic
959519843 3:107313026-107313048 ACTATTGCAAAAACTTGAGGAGG - Intergenic
960864592 3:122186232-122186254 CATATTGCATAACCTTGAACTGG + Intronic
962115953 3:132507885-132507907 AGAAATGATTAACCTTGATGAGG + Intronic
963323175 3:143832026-143832048 AGTATAGCATTTCCTTGATGAGG + Exonic
963623366 3:147640201-147640223 AGTAATCCATAATCTTGATTTGG - Intergenic
966041306 3:175491964-175491986 AGCAATGGATAACCTTGCTGAGG - Intronic
968694043 4:2012574-2012596 AGTATTGCATAACCTTGATGTGG + Intronic
974746245 4:66081701-66081723 AGTTTTCCATAACCTTAATTTGG - Intergenic
976701565 4:87974958-87974980 AGTATTGCATTTCATGGATGAGG + Intergenic
977332557 4:95655916-95655938 AGTATTCCATAAAATTGAGGTGG - Intergenic
978760310 4:112350328-112350350 AGCATTGCATTATTTTGATGAGG - Intronic
980094271 4:128473398-128473420 AGTTTTGAATCACCTTGATTAGG + Intergenic
980553027 4:134365331-134365353 ATTATAGCATAAACTTCATGAGG - Intergenic
985277655 4:188254178-188254200 AGTATTGCATGAGCAAGATGAGG - Intergenic
985799026 5:1990938-1990960 AATATTACAAAACATTGATGAGG + Intergenic
986524706 5:8661664-8661686 AATATTGCATAATCTTTAAGAGG - Intergenic
991516825 5:67445598-67445620 AGAATTACAAAACATTGATGAGG - Intergenic
997100855 5:130967899-130967921 AGTATTACATACCCTTCAAGTGG + Intergenic
998940470 5:147276683-147276705 ACTATAGCATAAGCTTAATGAGG - Intronic
1000036559 5:157453057-157453079 AGCATTGCTTGGCCTTGATGTGG - Intronic
1000479534 5:161754615-161754637 AGTATTCCAAAAACTTGAAGAGG - Intergenic
1000884093 5:166731174-166731196 AGTCTTGCATATCCTTGTTTGGG - Intergenic
1001939496 5:175730398-175730420 AGTTTTTCATAACCTTGTTATGG - Intergenic
1015870873 6:137775071-137775093 ATTATTGCATCAACTTTATGAGG - Intergenic
1017259315 6:152368775-152368797 GTTGTTGCATAAGCTTGATGTGG - Intronic
1017402073 6:154075934-154075956 AGTAATTCATAAAGTTGATGGGG - Intronic
1020349636 7:7204326-7204348 ACAACTGCATAACCTAGATGAGG - Intronic
1027483038 7:78723449-78723471 AATATTGCAAAACATTGATAAGG + Intronic
1027548523 7:79560732-79560754 AGGATTGCAGAAGCTTGATGGGG - Intergenic
1027980577 7:85214980-85215002 AATATTAAATAACCTTGATAGGG - Intergenic
1028443722 7:90894311-90894333 AGTATTACATAACTTTGAGCAGG - Intronic
1030483136 7:110129785-110129807 AGTTTAGAATAACCTTAATGTGG - Intergenic
1031093417 7:117390087-117390109 AGTATTCCATGACCTATATGTGG + Intronic
1031560495 7:123232280-123232302 AGTTTTGCAAAACCTTAATGAGG - Intergenic
1039689453 8:39848568-39848590 AGTATTGCTTTAACTTGGTGGGG + Intergenic
1042548218 8:69970192-69970214 AGTCTTGCCTTGCCTTGATGTGG - Intergenic
1047981774 8:130190926-130190948 ACTAGTACATAACCTCGATGGGG + Intronic
1052985561 9:34484686-34484708 AGTATTGAGTAACCTTAAGGTGG + Intronic
1058358561 9:104112712-104112734 AGTATTCTAAAACCTAGATGGGG - Intronic
1201769489 Y:17605574-17605596 AGTATTCCATAACATGTATGTGG - Intergenic
1201832065 Y:18300411-18300433 AGTATTCCATAACATGTATGTGG + Intergenic