ID: 968695658

View in Genome Browser
Species Human (GRCh38)
Location 4:2024957-2024979
Sequence CAGGATAAACAGTGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 3, 2: 1, 3: 29, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968695653_968695658 5 Left 968695653 4:2024929-2024951 CCTGGATCAGGGTGATTGGGAGG 0: 1
1: 1
2: 1
3: 17
4: 206
Right 968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG 0: 1
1: 3
2: 1
3: 29
4: 252
968695649_968695658 9 Left 968695649 4:2024925-2024947 CCACCCTGGATCAGGGTGATTGG 0: 1
1: 1
2: 6
3: 11
4: 106
Right 968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG 0: 1
1: 3
2: 1
3: 29
4: 252
968695648_968695658 10 Left 968695648 4:2024924-2024946 CCCACCCTGGATCAGGGTGATTG 0: 1
1: 1
2: 4
3: 7
4: 100
Right 968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG 0: 1
1: 3
2: 1
3: 29
4: 252
968695647_968695658 13 Left 968695647 4:2024921-2024943 CCACCCACCCTGGATCAGGGTGA 0: 1
1: 1
2: 5
3: 15
4: 229
Right 968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG 0: 1
1: 3
2: 1
3: 29
4: 252
968695652_968695658 6 Left 968695652 4:2024928-2024950 CCCTGGATCAGGGTGATTGGGAG 0: 1
1: 0
2: 1
3: 16
4: 168
Right 968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG 0: 1
1: 3
2: 1
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968695658 Original CRISPR CAGGATAAACAGTGGCAGCA TGG Intronic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
904348106 1:29886772-29886794 CAGGATTGACAGTGACAGCACGG - Intergenic
904852419 1:33468847-33468869 CAGGCCAATCTGTGGCAGCAAGG - Intergenic
906218547 1:44059359-44059381 CAGGATTAATAGTGACAACATGG - Intergenic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
908998593 1:70190218-70190240 AATGATAATCTGTGGCAGCAAGG - Intronic
909665927 1:78133449-78133471 CATGAAAAACACTGGCAGAAGGG + Intronic
910015856 1:82522298-82522320 CAGTATTAACAGTAGCAGTATGG + Intergenic
910037286 1:82803587-82803609 CGGGATAAACGGTGGGAGCAGGG + Intergenic
911577104 1:99590787-99590809 AAGGATAGGCAGTGGCAGCCAGG + Intergenic
912474907 1:109929054-109929076 CACAATAAATAGTGGCAGCATGG - Exonic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
917250473 1:173054328-173054350 CATGATAAACAGTGGTATTAGGG - Intergenic
917613577 1:176714815-176714837 CAGGATTAATAGTGCCAACATGG - Intronic
918403704 1:184191243-184191265 CAGGATAAACCCGTGCAGCAAGG + Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920405091 1:205703239-205703261 CAGAATAAACAGTGGCGACCAGG - Intergenic
920564025 1:206959725-206959747 AAGCATAAACAGGGCCAGCATGG + Exonic
921375995 1:214474463-214474485 TAGGATAAAAAATGGCAACAAGG + Intronic
921922460 1:220685131-220685153 CAGCATAAACAGTTGAAGCATGG - Intergenic
922335007 1:224612025-224612047 CAAGAAAAACAGTGGCTGGATGG + Intronic
922349066 1:224721082-224721104 GAGGACAAACCGAGGCAGCACGG - Intronic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
922866676 1:228866516-228866538 CGGGACAAGCAGTGGCTGCACGG + Intergenic
923247662 1:232148363-232148385 CAGGATCTCCAGTGGCAGCATGG - Intergenic
923351061 1:233107424-233107446 CAGGATAAATAATGTTAGCAGGG - Intronic
924526448 1:244855495-244855517 CAGGAAAAACAGGGGCACGAGGG + Exonic
1064579652 10:16780975-16780997 GAGAATTAAGAGTGGCAGCAGGG - Intronic
1064967477 10:21029818-21029840 CTGGATAGGCAGTGGCAGAAGGG + Intronic
1069042767 10:63712099-63712121 CAGGAAAAACACAGGCACCATGG - Intergenic
1070523328 10:77274095-77274117 CATGGTAAACAGTGGCAAGAGGG - Intronic
1070951931 10:80437966-80437988 GAGGATCAAAGGTGGCAGCAGGG + Intergenic
1070953193 10:80447117-80447139 GAGGATAAGCAGTTGCAGGAGGG - Intergenic
1071743793 10:88391926-88391948 CATGATAAACACTGGCAGTCTGG + Intronic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1071941045 10:90592197-90592219 CAGGAAAAGCAGTGAGAGCATGG + Intergenic
1072022287 10:91414076-91414098 CAGAAATAACAGTGGCAGCGAGG + Intronic
1073892013 10:108112943-108112965 CAGGATTAATAGTGATAGCATGG + Intergenic
1075247258 10:120833780-120833802 CAGGATGTTCAGGGGCAGCAAGG + Intergenic
1076468299 10:130700938-130700960 CAGGATCAACATTTGCCGCATGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082312212 11:50665313-50665335 CAGGATAAAAACTGGAAGAAAGG - Intergenic
1083299034 11:61730652-61730674 CAGCATCAACAGTGGCTGCTGGG + Intronic
1083763302 11:64830329-64830351 CAAGATAAACAGGCACAGCAGGG - Intronic
1086744762 11:90411123-90411145 CAAGGTAAACATTTGCAGCAAGG + Intergenic
1086931708 11:92700457-92700479 GAGGGTGACCAGTGGCAGCAGGG + Intronic
1088000582 11:104875666-104875688 CAGGATAACAAGTGACAGAAAGG - Intergenic
1089703289 11:120258804-120258826 CAGGGGCAAAAGTGGCAGCATGG - Intronic
1090665210 11:128910515-128910537 CAAGATAAATAGAGACAGCAAGG + Intronic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1090902651 11:131046410-131046432 CAGGGGAACCACTGGCAGCATGG - Intergenic
1091279503 11:134374005-134374027 CAGGACACAGAATGGCAGCACGG - Intronic
1091553489 12:1554404-1554426 CAGGAGAAAGAGTGGAAGGAAGG + Intronic
1094209831 12:27877569-27877591 GAGGATAAACTCTGGCAGGAGGG - Intergenic
1094375981 12:29787669-29787691 CAGAAGCAACAGTGGCAGCCCGG + Intergenic
1094864583 12:34515724-34515746 CAGGATAAAAACTAGCAGGAAGG - Intergenic
1095602169 12:44026297-44026319 CAGAAAAAAATGTGGCAGCAGGG - Intronic
1097701663 12:62826838-62826860 CAGGATAAATAATGGCATCATGG - Intronic
1098185521 12:67892311-67892333 CAGGATCAAAATTGGGAGCAGGG + Intergenic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1098473331 12:70870423-70870445 CAGAATAAAGAGTAGCAGTAGGG - Intronic
1098667943 12:73187890-73187912 CAGGATAATCATTGCTAGCATGG + Intergenic
1099349343 12:81545634-81545656 CAGAATAAAGACTGGCATCAGGG + Intronic
1100270444 12:93019669-93019691 GAGGAGAGACAGTGACAGCAAGG - Intergenic
1101334710 12:103786228-103786250 CAGGATAAGGAGAGGAAGCAAGG + Intronic
1103840403 12:123859124-123859146 CGGGACAAACAATGGCAGCTGGG - Intronic
1104874741 12:132026173-132026195 CAGGATGAGGAGTGGCAGCTCGG - Intronic
1105302403 13:19147875-19147897 CAGCATAAACACTGCCAGCTTGG - Intergenic
1106446587 13:29838164-29838186 TAACATAAACAGTGGCAGCCAGG + Intronic
1107731607 13:43354839-43354861 CAGGATAAAAAGAGGCATAAAGG - Intronic
1107820983 13:44285469-44285491 AAGGGTCAACAGTGGAAGCAGGG - Intergenic
1108905480 13:55466285-55466307 CATGAGCAACAGTAGCAGCAAGG - Intergenic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109308440 13:60664463-60664485 CAGGATATACAGTGGGGCCATGG + Intergenic
1111430944 13:88147462-88147484 CAAGATGAACAGTGACAACATGG + Intergenic
1115191828 14:30754780-30754802 CAGAACCCACAGTGGCAGCATGG - Intergenic
1115637030 14:35299676-35299698 CAGGGTAAACAGTAGTATCATGG - Intronic
1116309202 14:43300379-43300401 CAGGAAAAACAGGGGCACGAGGG - Intergenic
1118425373 14:65654871-65654893 CAGGACAAAGACTGGCAGAATGG + Intronic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122559943 14:102606016-102606038 CAGGAGAATCACTGGAAGCAGGG - Intronic
1124205139 15:27712023-27712045 CAGCAGAAACAGTGCCAGCTTGG + Intergenic
1128394599 15:67211282-67211304 CAACCTCAACAGTGGCAGCATGG + Intronic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1129927935 15:79382765-79382787 CAGGATGAGGAGTGGCAGGAAGG - Intronic
1131368401 15:91859362-91859384 CAGGAAAAACAGTGGAATCATGG + Intronic
1132664860 16:1076841-1076863 CAGGATCCACAGAGACAGCATGG - Intergenic
1133080774 16:3318109-3318131 CAATAGAAACATTGGCAGCATGG + Exonic
1134686941 16:16165638-16165660 GAGGAGAAACAGTGGCAGGATGG + Exonic
1137309012 16:47234939-47234961 CAGGAGAATGAGTGCCAGCAGGG - Intronic
1137893441 16:52185780-52185802 CAGCAGAAGCAGTGGAAGCATGG - Intergenic
1137898833 16:52243323-52243345 GTGGATACACAGTGACAGCAGGG + Intergenic
1140039470 16:71396597-71396619 TAGCATCAACAGTGGCACCAAGG + Intergenic
1141355156 16:83338678-83338700 AAGGATGAATAGCGGCAGCAAGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1146299104 17:31674342-31674364 CAGGATAGACACTGGAGGCATGG - Intergenic
1146566510 17:33917523-33917545 CAGGAACAAGAGTGGTAGCAAGG - Intronic
1146807749 17:35878788-35878810 ATGGATAAACAGTGGCAGAGTGG + Intronic
1147898191 17:43765949-43765971 CTGCATAAACAGTGCCATCATGG + Intergenic
1148604613 17:48919676-48919698 CAGGATCAGCATTGGCAACATGG - Intronic
1151775323 17:76197261-76197283 CAGGAGAAACAGTTACAGTAAGG + Intronic
1151924383 17:77183798-77183820 AAAGATAAACAGAAGCAGCAAGG - Intronic
1152473849 17:80504717-80504739 CAGGACAGACTGTGGCACCATGG + Intergenic
1154143146 18:11843430-11843452 CAGGATAATCACTTGAAGCAGGG + Intronic
1154390455 18:13932224-13932246 CAGAATCCACAGTGGCATCATGG + Intergenic
1155680616 18:28481762-28481784 CAGGATTAACAGTGGCAGCATGG - Intergenic
1155844980 18:30695021-30695043 CAGCAACAACAGTGGCAGTATGG + Intergenic
1155971136 18:32084761-32084783 CAGGATAAACAGGGTCACCGGGG + Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1158609345 18:58924418-58924440 AACCATGAACAGTGGCAGCAAGG - Intronic
1159370085 18:67517476-67517498 CAGTATAAATAGGGGAAGCATGG + Intergenic
1160277738 18:77453494-77453516 CTGGAGAAACAATGGCACCAAGG - Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1165850507 19:38847789-38847811 AAGGAGATACACTGGCAGCAAGG + Intronic
925394571 2:3523786-3523808 CAGGAGCAACAGCGGTAGCAGGG + Intergenic
925953119 2:8934735-8934757 GAGAATAAAATGTGGCAGCAAGG - Intronic
926283918 2:11472378-11472400 GAGGAGAAAGAGTGACAGCAAGG + Intergenic
927083411 2:19652368-19652390 GAGGAGAGACAGTGGTAGCAAGG - Intergenic
928217584 2:29375124-29375146 CATGAGAAACAGCAGCAGCAAGG + Intronic
929295547 2:40242427-40242449 CAACATAAACACAGGCAGCATGG - Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930126134 2:47798490-47798512 AATGAAAAACAGTGGCTGCACGG + Intronic
932614625 2:73224060-73224082 AAAGATAAACTGTGGCTGCAAGG - Intronic
935143394 2:100376432-100376454 CACCATAAACAGGGGCAGCAAGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
937433427 2:121860210-121860232 CCAGATAAACAGTGTCAGAATGG + Intergenic
938729121 2:134132305-134132327 CAAGATAAACAGTTTCAGAAAGG - Intronic
939349769 2:141020574-141020596 AAGGATGAACAGTTTCAGCAGGG + Intronic
942771542 2:179526711-179526733 TAGGAGAAGCAGTGTCAGCAAGG - Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943415240 2:187593447-187593469 TAGTATAAAAAGTGGCAGTAAGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
946983528 2:225246404-225246426 CAGGATGAAGGGTGGCAGGAGGG - Intergenic
947801562 2:232931682-232931704 CAGCAGAAACAGTGCCAGCTGGG + Intronic
1170388762 20:15849839-15849861 CTGGATAAACAATGGCTCCATGG + Intronic
1170574995 20:17655640-17655662 CAGTGTAAACTGTGGCAGCCAGG - Intronic
1173264971 20:41470883-41470905 CAGGAGGATCAGTGGAAGCATGG - Intronic
1173368236 20:42408836-42408858 CTAGATAAACAGTGGCAGATTGG + Intronic
1173395331 20:42673875-42673897 GAGGAAAAACAGCGTCAGCATGG - Intronic
1173431240 20:42988672-42988694 CAGGAGAGACAGTGGCTGCAGGG + Intronic
1173980909 20:47223411-47223433 CAGGAGAATCAGTGGAAGCCAGG + Intronic
1175524558 20:59624551-59624573 CAGGCTACACAGGAGCAGCATGG - Intronic
1175663131 20:60834832-60834854 GAGGAAAAACAGTTGCAGGAGGG - Intergenic
1176069186 20:63217195-63217217 CAGGGTGAACAGTGACAGCAGGG + Intergenic
1177302367 21:19264801-19264823 ATGGATAAACTGTGGCAGAATGG - Intergenic
1177630858 21:23725646-23725668 CAAGATCAAATGTGGCAGCAGGG - Intergenic
1178107441 21:29335811-29335833 CAGGAACAACAGTGACACCAAGG - Intronic
1179413808 21:41181970-41181992 CAGAATTAACAGTGGCATCATGG + Intronic
1180107519 21:45629857-45629879 CAGGATTAGCGGTGTCAGCAGGG - Intergenic
1180960887 22:19761729-19761751 CAAGATAAAGAGCGGCAGCCGGG + Intronic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950069115 3:10137793-10137815 AGGGATTAACAGTGGAAGCAGGG + Intergenic
951664670 3:25109338-25109360 TAGAATAAACACTGGAAGCATGG + Intergenic
951726336 3:25765162-25765184 CAAGATAAAAAGTTGCAGCTGGG + Intronic
951833112 3:26951933-26951955 CAGGATTAACAGTGGCAAAATGG + Intergenic
952428765 3:33201832-33201854 CAGGAAGAACAGGGGTAGCAAGG - Intronic
953935551 3:47038774-47038796 TAGGATAAAAAGTGGAAGTAAGG + Intronic
954087787 3:48259595-48259617 CAGGGTAATCAGAGGCAGCTGGG + Intronic
954451935 3:50576338-50576360 CAGGAAAAACTCTGGGAGCAGGG + Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
956353002 3:68358980-68359002 CAGGACAAAAAGTGGCAGATTGG - Intronic
958595608 3:96217748-96217770 CAGGATTAACAGTGGCAGCATGG + Intergenic
958874362 3:99598834-99598856 GAGCATAATGAGTGGCAGCATGG - Intergenic
960237341 3:115299122-115299144 CATGAAAAACACTGGGAGCAAGG + Intergenic
960299761 3:115987488-115987510 CAGGAACTACAGTGGCAGCTGGG + Intronic
960915493 3:122690269-122690291 ATGGCTAAAGAGTGGCAGCAGGG + Intronic
962630520 3:137270997-137271019 CAGAAGAAAGAGTGGAAGCAGGG - Intergenic
962874767 3:139527454-139527476 CAGGAAAATCAGGGACAGCAGGG + Intronic
963534186 3:146507561-146507583 CAGGCTAGACAGTGGCAGCCTGG + Intergenic
964063879 3:152558165-152558187 CAGTAAAAAGAGTGGCTGCATGG + Intergenic
965231641 3:166061282-166061304 AAAAATAAACAGTGGCAGCCAGG + Intergenic
966278729 3:178206049-178206071 CAGGGTAAACTCTTGCAGCAGGG - Intergenic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
969117569 4:4881209-4881231 CAGGACAACCAGTGGTAGGAGGG - Intergenic
969624538 4:8295597-8295619 CAGGAGACACAATGGCAGGAGGG - Intronic
973739710 4:53907993-53908015 CAGGATAATCAGTTGCACCTGGG - Intronic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
974685159 4:65217471-65217493 CAGGACAAACAGTGGCAGTCTGG - Intergenic
975127841 4:70802116-70802138 CATGATAAACAGAGGCAACTTGG - Intronic
976554348 4:86433017-86433039 CAGGATCAACTGTAGCAACAGGG + Intronic
977657739 4:99542024-99542046 CAGCAAAACCAGTGTCAGCAAGG + Exonic
978836942 4:113162256-113162278 GAGGATAAGCAGTGTCATCAGGG - Intronic
980701733 4:136441780-136441802 CAGGAGCAGCAATGGCAGCATGG + Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
985645073 5:1080953-1080975 CAAGATAAGCAGGGGCAGGAAGG + Intronic
986422239 5:7597204-7597226 CAGGAGAAGGAATGGCAGCAGGG + Intronic
987778670 5:22402911-22402933 AAGCATAAACATTGGCAGCTTGG + Intronic
993113797 5:83693706-83693728 CAGGATAAAAAATATCAGCAGGG + Intronic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
998265246 5:140663191-140663213 CAGGGTAGACAGTGGCAGCGTGG - Intergenic
998643272 5:144036009-144036031 CAGGATAAAGCATGGCTGCAGGG + Intergenic
999173670 5:149616669-149616691 CAGGATAGGCACTGGCATCAGGG - Exonic
999247246 5:150161714-150161736 TAGGATAATCAGTGGCATCCGGG + Intergenic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
999700337 5:154221814-154221836 CAGCATAAAGAGTGGCAGGAAGG - Intronic
1001041424 5:168338216-168338238 CAGGAGAATCACTGGAAGCAGGG + Intronic
1001557298 5:172645472-172645494 CAGGGAAAACAGTGGCTGCCAGG - Intronic
1001585027 5:172828029-172828051 CAGCCTAAACAGTGGCTCCAGGG - Intergenic
1003602312 6:7528859-7528881 CAGGATAATCAGTGTCATGAAGG + Intergenic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006116567 6:31779008-31779030 CAGGATAGCCCGAGGCAGCACGG + Exonic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009779312 6:68249121-68249143 CAGGTCAAACTGTGGAAGCAGGG + Intergenic
1010577760 6:77553740-77553762 CAGGAGAAACACTAGCAGCAGGG + Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1011207175 6:84912496-84912518 CAGGATAGACGTTGGCAGCCTGG - Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011579661 6:88846267-88846289 AAAGATAACTAGTGGCAGCATGG - Intronic
1011612457 6:89166958-89166980 CAGGATTAACAGTAGCCTCATGG + Intergenic
1012093596 6:94931366-94931388 CAGGATAAACCGAGGCAACTAGG - Intergenic
1013362800 6:109410309-109410331 CAGGATGAACAGTGACAACATGG - Intronic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1016367701 6:143337210-143337232 CAGCAGAAACATTGACAGCATGG - Intronic
1018257539 6:161936876-161936898 CAGGATAATCAGTTGCACCCGGG - Intronic
1018294982 6:162336047-162336069 CAGGGTAAGCAAGGGCAGCAAGG + Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1023207505 7:37766575-37766597 CAGGGTCAACAGTGACTGCAGGG + Intronic
1024283467 7:47737820-47737842 CAGGGCAGACAGTGGCAACAGGG + Intronic
1027797434 7:82712357-82712379 CAGGACTCACAGTGACAGCATGG + Intergenic
1029097947 7:98104113-98104135 CAGGACAGACACTGGCAGGAGGG + Intergenic
1031387956 7:121175946-121175968 TCAGAGAAACAGTGGCAGCAGGG + Intronic
1033858710 7:145598109-145598131 TAGGATAAACAGTGACAGATGGG - Intergenic
1034290874 7:149930637-149930659 CAAGATAAAATGTGGCAACAGGG + Intergenic
1034815312 7:154167135-154167157 CAAGATAAAATGTGGCAACAGGG - Intronic
1037158111 8:15731255-15731277 CAGGATAAAAAATAGTAGCAGGG + Intronic
1038376476 8:27045093-27045115 TACGAGAAACAGTGGAAGCATGG + Intergenic
1039741578 8:40387846-40387868 CAGCTTTAACAGGGGCAGCAAGG + Intergenic
1041530476 8:58860176-58860198 CATTAGAAACAGTGGCAGCTAGG - Intronic
1041866941 8:62584786-62584808 CAGGATTTACAGTAGCAGAAGGG - Intronic
1041894811 8:62911826-62911848 CAGGATAATCCGTGGAAGCATGG + Intronic
1042747442 8:72122552-72122574 CAAGATTAACAGTGACAGCTTGG + Intergenic
1042760836 8:72269921-72269943 CTGGATTAACAGTGACAGCTTGG - Intergenic
1043495887 8:80799505-80799527 CAGGAAAAACTGAGGCAGCTAGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044608290 8:94066478-94066500 TATGATAAATAGTGCCAGCATGG + Intergenic
1044875796 8:96665173-96665195 CAGGGTAAAGAATGGCAGAAAGG + Intronic
1045540450 8:103079359-103079381 ATGGATAAACAATGGCAGCCCGG - Intergenic
1046604752 8:116358943-116358965 CATGATAAACTTTGGTAGCATGG - Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047725449 8:127680093-127680115 CATGAGAAATAGAGGCAGCAAGG - Intergenic
1048662708 8:136623682-136623704 CAGGATAGACAGGGGCATCTGGG - Intergenic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1052573704 9:30264401-30264423 TGGAATAAACAGTGGTAGCAAGG - Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1055990918 9:82104838-82104860 CAGGTAAAACTGTGGCAGGAAGG + Intergenic
1056918606 9:90765570-90765592 CAGAATTAACAGTGACAGCATGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058899817 9:109432323-109432345 TTGGCAAAACAGTGGCAGCAAGG - Intronic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059324781 9:113497583-113497605 CCAGATAAACAGTGGAGGCATGG - Intronic
1060816590 9:126638410-126638432 CAGGGCAGCCAGTGGCAGCAGGG - Intronic
1061667590 9:132169432-132169454 CACAATAAACTGTGGCATCAGGG - Intronic
1061673907 9:132204545-132204567 CAGGAAAAACAGGGGCAAGAAGG + Intronic
1186167562 X:6843200-6843222 CAGGCTAAACAGGGGCACCCTGG + Intergenic
1186197015 X:7119356-7119378 AAGGTGAAACAGTGACAGCACGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188442719 X:30229199-30229221 CAGGACAAAGAGTGCCAGCACGG - Intergenic
1190485446 X:50919135-50919157 CAAGAAAAACACTGGCAGGATGG + Intergenic
1191099598 X:56711461-56711483 CAGGTGAAAGAGTGGGAGCAGGG + Intergenic
1191904621 X:66075529-66075551 CCGGATAGGCAGTGGCAGAAGGG - Intergenic
1193326167 X:80180728-80180750 CAGGACAAACAATGACAACATGG - Intergenic
1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG + Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1194012858 X:88583968-88583990 CAGGATCAATAAAGGCAGCAAGG + Intergenic
1194191810 X:90846694-90846716 CAAGATACAGAGTGGCAGAATGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1195447704 X:104972675-104972697 CAGTATTAATAGTGACAGCATGG + Intronic
1195966441 X:110434091-110434113 CAGGAGGAACAGTGGAGGCAGGG + Intronic
1196712279 X:118775287-118775309 CAGGGTAGAGAGTGGCAGCGAGG + Intronic
1196728600 X:118920068-118920090 CATGCTAAATAGTGGCAGCGAGG - Intergenic
1198272450 X:135067355-135067377 CAGGATTAACAGTGGCAGCATGG - Intergenic
1198715182 X:139551111-139551133 CAGGAAAAACAGTCTCAGCACGG - Exonic
1199031291 X:143003622-143003644 AAGGATATACAGTGAAAGCAAGG - Intergenic
1199596187 X:149507950-149507972 GAGGATATAGAGAGGCAGCAAGG + Intronic
1200538453 Y:4429128-4429150 CAAGATACAGAGTGGCAGAATGG - Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1200914246 Y:8557370-8557392 CAGGATAAAAAGAGGCAGTGAGG + Intergenic