ID: 968697114

View in Genome Browser
Species Human (GRCh38)
Location 4:2036602-2036624
Sequence GCTCCACTACAACATGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968697114 Original CRISPR GCTCCACTACAACATGTTCA GGG Intronic
914907480 1:151758381-151758403 GGTACACTTCAACATGCTCATGG + Intergenic
915498047 1:156295016-156295038 CCTCCACTACTCCATGTTCCAGG - Exonic
915798675 1:158765505-158765527 ACTGCACTACATCATGTTGAAGG + Intergenic
917833785 1:178923261-178923283 GCTACACTATAACATGCTTAGGG - Intergenic
918260070 1:182787680-182787702 ACTCCACTGCAAGGTGTTCAAGG - Intergenic
1071407569 10:85353170-85353192 GTTCCACTACAAAGTCTTCAGGG - Intergenic
1097224967 12:57471650-57471672 CCCCCACTACAAAATTTTCATGG - Exonic
1102383067 12:112483933-112483955 GCTCCACTTCAATGTGTCCAAGG - Intronic
1103269933 12:119664863-119664885 TCCCCACTACATCATGGTCATGG - Intergenic
1112144295 13:96680300-96680322 GCTGCACTACAACATCTTTTTGG - Intronic
1114632922 14:24171320-24171342 GCTCCACTCCAACCTGGGCAAGG - Intergenic
1121214406 14:92236158-92236180 GCCCCACTGCATCATGTTAAGGG + Intergenic
1124846667 15:33298127-33298149 GCTTCACTAAAACAAGTACATGG - Intergenic
1130080205 15:80726290-80726312 GCAGCACTGTAACATGTTCATGG - Intronic
1130836574 15:87655597-87655619 GCCCCACTACAACATCAGCAAGG + Intergenic
1134021140 16:10922407-10922429 CGTCCAGTACAACAAGTTCACGG + Exonic
1135518100 16:23151959-23151981 GATTCACTACAGAATGTTCAAGG - Intergenic
1135918612 16:26627807-26627829 TCTCCACTTCAACATGAACAAGG + Intergenic
1141498723 16:84428907-84428929 GCACCACTGCATCATTTTCATGG - Intronic
1143727926 17:8862674-8862696 GCTCATCTAAAACATGCTCATGG - Intronic
1144370491 17:14585670-14585692 GCTCAATTAACACATGTTCATGG - Intergenic
1146038233 17:29426874-29426896 GCTCTACTATAAAATATTCAAGG - Intronic
1146168752 17:30615676-30615698 TCTACACTTCATCATGTTCATGG - Intergenic
1146221728 17:31029169-31029191 TCTACACTTCATCATGTTCATGG - Intergenic
1149970166 17:61209964-61209986 GCTCCCCTACAAAATGATCCAGG - Intronic
1156080380 18:33326910-33326932 GCTGCATTACAACATGTCAAAGG - Intronic
1165185153 19:34013364-34013386 ACTCCACCAAAACATGTTTAGGG + Intergenic
1168171422 19:54592440-54592462 GCTCCACTGCACCATGTATAGGG - Intronic
925294485 2:2768243-2768265 CCTCCACTACAAGATGGTCCTGG + Intergenic
925296818 2:2782639-2782661 GCTCCACCAGCACTTGTTCAGGG - Intergenic
927769214 2:25843738-25843760 GCTGCAGTACACCATGATCATGG + Intronic
931725626 2:65107731-65107753 GCTCCAGTACAGCAAATTCAGGG - Intronic
931979802 2:67682571-67682593 GCTCCACCACAAAAACTTCAAGG - Intergenic
937483948 2:122294053-122294075 CCTACAATACAACATGTTCTTGG + Intergenic
940131474 2:150387700-150387722 AGTCCATTACAACATCTTCAGGG - Intergenic
945412536 2:209528235-209528257 GCTCACCTACAACAGGTTCTAGG - Intronic
1170224931 20:13981965-13981987 GCTCCTCTGCAACATGTCCAGGG + Intronic
1175014226 20:55771350-55771372 GCCCCACTTTTACATGTTCATGG + Intergenic
1177383435 21:20376026-20376048 GCTCCATTGCAAGATGTTCATGG - Intergenic
1181589743 22:23876768-23876790 GCCACAGTACCACATGTTCATGG - Intronic
1184791755 22:46704213-46704235 GCTGCACTTCACCATGGTCAGGG - Intronic
949307468 3:2658834-2658856 TCTCCAATAGAGCATGTTCAAGG + Intronic
960328421 3:116326181-116326203 ACTCCACTGGAACATGGTCAGGG - Intronic
960370390 3:116830384-116830406 TGTCCTCTACAACATGCTCAGGG + Intronic
964512983 3:157473961-157473983 GATCCAGTACAACATGTTCCAGG - Intronic
965945302 3:174233178-174233200 GCTCCAGTAAAAAAAGTTCAAGG + Intronic
968697114 4:2036602-2036624 GCTCCACTACAACATGTTCAGGG + Intronic
973236605 4:47913278-47913300 GCTCCACGAAAACATGGTCTTGG + Intronic
978112459 4:104978927-104978949 CCACCACTACCACAGGTTCATGG - Intergenic
980412371 4:132438927-132438949 GCTCCAATACAAGCTGTTAAGGG + Intronic
983200319 4:164853949-164853971 GCTCAACTACATTAAGTTCAGGG - Intergenic
987942185 5:24553785-24553807 TCTCCATTACAAAATATTCAAGG - Intronic
994713224 5:103291421-103291443 GCTCCTCTACATCATTTTCTTGG - Intergenic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
1001239291 5:170055992-170056014 GCTCCATTACAACCTGGGCATGG - Intronic
1003568359 6:7239474-7239496 GCTCCTCTACAACTTGTCCTGGG - Intronic
1004951328 6:20675900-20675922 GCTCCACTAGAAGACTTTCAGGG - Intronic
1008792163 6:55249346-55249368 TCTACACTAAAACCTGTTCATGG - Intronic
1022206494 7:28169270-28169292 GCTCCACTTCAGCACTTTCAGGG - Intronic
1022312235 7:29208259-29208281 GCTCCCCTTCAAGTTGTTCATGG + Intronic
1023345772 7:39269692-39269714 GCTTCACTTCAACAGGCTCAGGG - Intronic
1023518983 7:41031936-41031958 GCTTCACTCCATCATGCTCATGG + Intergenic
1024354213 7:48397566-48397588 TCTCCACTAAAAGATTTTCAGGG - Intronic
1032960389 7:137026951-137026973 TCTCAACCTCAACATGTTCAAGG + Intergenic
1039747698 8:40444796-40444818 CCTCCAATAAGACATGTTCATGG - Intergenic
1049052659 8:140210772-140210794 GCTCTACTGCAAGATTTTCAAGG + Intronic
1051553825 9:18360295-18360317 GCTACACAAAAACATGTTGAAGG + Intergenic
1058108393 9:101002257-101002279 GCCACATTACAACATGTTGACGG - Intergenic
1186411433 X:9347709-9347731 GCTCCAGTCCCAAATGTTCACGG + Intergenic
1187277435 X:17828274-17828296 GCTCCACTACAAAATCTGCAGGG + Intronic
1188337814 X:28959934-28959956 GTTACATTACATCATGTTCAGGG - Intronic
1196487238 X:116226626-116226648 GCTCCACTACATAATTTACAGGG - Intergenic
1197684776 X:129427597-129427619 GCTCCTCAACCACTTGTTCATGG - Intergenic
1197854433 X:130900114-130900136 GCTCTTCTAAAACATGTTAATGG + Intronic
1198409363 X:136350152-136350174 GCTCTACAATAACATCTTCATGG + Exonic
1198939060 X:141932597-141932619 ACTCCACTACAGCATCTTAATGG - Intergenic
1202603107 Y:26614622-26614644 GCTCCACTGCAACCTGTTGGAGG - Intergenic