ID: 968698129

View in Genome Browser
Species Human (GRCh38)
Location 4:2042487-2042509
Sequence AGGTGCCGGGGGCCGGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 264}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968698119_968698129 -6 Left 968698119 4:2042470-2042492 CCGTCCCCGCGCAGAGTAGGTGC 0: 1
1: 0
2: 0
3: 9
4: 78
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698108_968698129 24 Left 968698108 4:2042440-2042462 CCCGGGCCCGCGCCGAGCCCGCC 0: 1
1: 0
2: 5
3: 61
4: 632
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698121_968698129 -10 Left 968698121 4:2042474-2042496 CCCCGCGCAGAGTAGGTGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 119
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698116_968698129 6 Left 968698116 4:2042458-2042480 CCGCCGGGAGTGCCGTCCCCGCG 0: 1
1: 0
2: 1
3: 3
4: 70
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698109_968698129 23 Left 968698109 4:2042441-2042463 CCGGGCCCGCGCCGAGCCCGCCG 0: 1
1: 1
2: 4
3: 62
4: 518
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698117_968698129 3 Left 968698117 4:2042461-2042483 CCGGGAGTGCCGTCCCCGCGCAG 0: 1
1: 0
2: 1
3: 5
4: 85
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698112_968698129 18 Left 968698112 4:2042446-2042468 CCCGCGCCGAGCCCGCCGGGAGT 0: 1
1: 0
2: 0
3: 5
4: 119
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698114_968698129 12 Left 968698114 4:2042452-2042474 CCGAGCCCGCCGGGAGTGCCGTC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698115_968698129 7 Left 968698115 4:2042457-2042479 CCCGCCGGGAGTGCCGTCCCCGC 0: 1
1: 0
2: 1
3: 6
4: 128
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264
968698113_968698129 17 Left 968698113 4:2042447-2042469 CCGCGCCGAGCCCGCCGGGAGTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG 0: 1
1: 0
2: 1
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968698129 Original CRISPR AGGTGCCGGGGGCCGGGTTC CGG Intronic
900174141 1:1284357-1284379 AGGTACCAGGGGCTGGGTTGGGG + Intronic
900506107 1:3030452-3030474 AGCTGCCGTGGGCCGAGGTCGGG + Intergenic
900984837 1:6067074-6067096 GGGTCCCGGGAGCAGGGTTCTGG + Intronic
901066763 1:6497971-6497993 AGGTGGCGGGGGCTGGGGACTGG - Intronic
901692471 1:10982416-10982438 AGGGGCCTGGAGCAGGGTTCTGG - Intergenic
901802989 1:11719869-11719891 AGGTGCTGCGGGCCGGCTCCTGG - Exonic
901931190 1:12596833-12596855 AGGTGCAGGGGGCCTGGCACGGG + Intronic
902304180 1:15524497-15524519 CGGTGACGTGGGGCGGGTTCTGG - Intronic
902918851 1:19654953-19654975 AGGTGCAGGGGGCCGGGTAGTGG - Intronic
903065267 1:20696184-20696206 ACGGGCCAGGAGCCGGGTTCCGG - Intronic
903211742 1:21822743-21822765 AGGTGCCAGGGGCTGGGTGGAGG + Exonic
903374177 1:22855375-22855397 AGGGGCCAGGGAGCGGGTTCTGG - Intronic
903700883 1:25247487-25247509 ATGCGCCGGGGGCCAGCTTCTGG - Exonic
903882819 1:26523307-26523329 AGGGGCTGAGGGCCGGGTTTTGG - Intergenic
905442783 1:38005566-38005588 GGGGGCCGGGGGCGGGGTCCGGG - Intronic
905960103 1:42035955-42035977 AGGGGGCGGGGCCCGGGGTCTGG - Intergenic
907085783 1:51672497-51672519 AGTTGCCTGGGGCCGGGGGCTGG - Intronic
916213056 1:162373954-162373976 AGGTGATGAGAGCCGGGTTCTGG + Exonic
922185871 1:223273852-223273874 AGGTGCGTAGGGCAGGGTTCAGG - Intronic
923204143 1:231741762-231741784 AGGAGCTGGGAGCAGGGTTCAGG - Intronic
1062840453 10:666439-666461 TGCTGCCGCGGGCCGGGCTCTGG - Intronic
1064019069 10:11794813-11794835 AGGTTCTGAGGGCCGGTTTCAGG + Intergenic
1064166906 10:12994429-12994451 AGGTGCTGGGTGCTGGGTGCTGG - Intronic
1065140276 10:22713788-22713810 AGCTGCTGGGGGCCGGGTCCGGG - Intronic
1067410515 10:46060425-46060447 AGGAACTGGGGGCCTGGTTCTGG - Intergenic
1067513912 10:46920543-46920565 GGGTGCTGGGGGCAGGGTTCAGG + Intronic
1067567607 10:47349979-47350001 AGGTGCACGGGGCCGGCCTCAGG - Exonic
1067648342 10:48131289-48131311 GGGTGCTGGGGGCAGGGTTCAGG - Intergenic
1067792227 10:49296989-49297011 ATGTTCCGGGGGCCGGGCACTGG - Intergenic
1070863914 10:79694560-79694582 GGGTGCTGGGAGCTGGGTTCTGG - Intergenic
1071630812 10:87216786-87216808 GGGTGCTGGGAGCTGGGTTCTGG - Intergenic
1073099665 10:100999951-100999973 AGGTGAGGGGGGCCGGGTCTGGG + Exonic
1074585889 10:114767906-114767928 GGCTGCCGGGGGCCGGGGGCAGG - Intergenic
1074772323 10:116742250-116742272 CGGGGCCGGGGGCCGGGGTCCGG - Intronic
1075597673 10:123743935-123743957 AGGTTCCGGGCTCCGGGTTAAGG + Intronic
1076490230 10:130855765-130855787 AGCTGCCTGGGGCTGGGTGCAGG + Intergenic
1076613602 10:131742499-131742521 AGGTGCTGGGGCCCAGGATCTGG - Intergenic
1076662259 10:132063348-132063370 AGGTGCTGGGGCTCGGTTTCTGG + Intergenic
1076720727 10:132391566-132391588 AGGGGCCCTGGGCTGGGTTCGGG + Intergenic
1077327191 11:1968970-1968992 AAGTGCCCAGGCCCGGGTTCAGG + Intronic
1077332682 11:1990304-1990326 AGGTGCAGGGGTCAGGGCTCTGG - Intergenic
1077333337 11:1992953-1992975 AGGTGGTGGGGGCAGCGTTCAGG - Intergenic
1077445473 11:2588605-2588627 ATGTGGCGGGGGCTGGGCTCGGG + Intronic
1078091739 11:8268402-8268424 AGGTGCCCGGCGCCCGGTGCCGG - Intronic
1080588450 11:33700915-33700937 AGGTGGGCGGGGCCGCGTTCCGG - Intronic
1080727966 11:34916414-34916436 ACGGGGCGGGGGCCGGGGTCTGG + Exonic
1081666489 11:44919896-44919918 AGGTGCCGGAGGCCTGCTGCCGG + Exonic
1081705971 11:45181991-45182013 AGCTGCCGGGAGCAGGGTTAGGG - Intronic
1081969210 11:47186467-47186489 CGGGGCCGGGGGCCGGGGGCCGG - Intergenic
1082076531 11:47980226-47980248 AGGTCCACGGCGCCGGGTTCGGG - Intergenic
1083603269 11:63961850-63961872 AGCTGTCGGGGGCGGGGTTGGGG - Intergenic
1083960448 11:66012283-66012305 AGGTGCGGCGGGCGGGGTGCTGG + Exonic
1084129126 11:67119602-67119624 CGGGGCCGGGGCCCGCGTTCCGG + Intronic
1090541398 11:127710545-127710567 AGGGGTGGGGGGCCGGGTTGGGG - Intergenic
1202810173 11_KI270721v1_random:24150-24172 AAGTGCCCAGGCCCGGGTTCAGG + Intergenic
1202815665 11_KI270721v1_random:45480-45502 AGGTGCAGGGGTCAGGGCTCTGG - Intergenic
1202816317 11_KI270721v1_random:48134-48156 AGGTGGTGGGGGCAGCGTTCAGG - Intergenic
1094713283 12:32986468-32986490 GGGTGTTGGGGGCCGGGTCCTGG - Intergenic
1096116977 12:49060484-49060506 CGGTGCCGGGAGCCGGGGTTGGG - Intergenic
1096537674 12:52285978-52286000 AGTTGCCGTGGGCAAGGTTCTGG + Exonic
1096796740 12:54082568-54082590 CGGGGCCGGGGGCCGGGGCCGGG + Intergenic
1098369129 12:69738829-69738851 CGGGGCCGGGGGCCGGGAGCCGG - Intronic
1100427512 12:94500972-94500994 AGGTGCAAGGGGCAGAGTTCAGG - Intergenic
1102969550 12:117155474-117155496 AGGAGCCGAGGGCAGGGTCCAGG + Intronic
1104648706 12:130515379-130515401 AGGTGCCAGGGGCTGGGTAGAGG - Intronic
1104906320 12:132215357-132215379 CGGTGCCGGGCGCCGCGTCCTGG - Intronic
1105031408 12:132887158-132887180 CGGGGCCGGGGGCCGGGGCCGGG - Intronic
1105299205 13:19117728-19117750 CGGTGGCGGGGGACGGGTTAGGG - Intergenic
1105414004 13:20193307-20193329 CTGTGCCGTGGGCGGGGTTCAGG + Intergenic
1105754318 13:23451173-23451195 AGGTGTCTGGGGCCTGGTCCTGG - Intergenic
1108082444 13:46750699-46750721 AGGTGCCTGGAGCAGAGTTCAGG - Intronic
1113185545 13:107682527-107682549 AGGTCCCGGGGGCCTCGTTCGGG - Intronic
1113377891 13:109782119-109782141 GGGTGCGGGGGGCCGGGTCCCGG - Exonic
1113744524 13:112734267-112734289 AGGTGCAGGGGGCGGGGGTGAGG + Intronic
1113940529 13:114016400-114016422 CCGTGCCAGTGGCCGGGTTCGGG - Intronic
1114100173 14:19372967-19372989 AGGTGCTGGGCGCCCGGTGCCGG - Intergenic
1119106753 14:71932320-71932342 AGGTGCCGGGGCCCAGGTGCCGG + Intergenic
1119777564 14:77258277-77258299 ATGTGCCTGGGGCCTGGTGCAGG - Exonic
1121045080 14:90781877-90781899 AGGTGCCGGAGGACGGGTCAGGG - Intronic
1121595160 14:95156992-95157014 AGGCGCCGGGGTCCGGGCCCAGG + Intronic
1121645797 14:95516536-95516558 GGGGGCCGGGGGCCGGGGGCCGG - Intronic
1121645802 14:95516543-95516565 TGGGGCCGGGGGCCGGGGGCCGG - Intronic
1121764632 14:96475488-96475510 AGTTGCCTGGGGCCTGGTCCTGG + Intronic
1121950608 14:98167832-98167854 AGGGGCAGGAGGCCGAGTTCCGG - Intergenic
1122326475 14:100883653-100883675 AGGTTCCGGGGGCGGGCCTCGGG + Exonic
1122604256 14:102937958-102937980 GGGTGACGGGGGCAGGGGTCGGG - Intronic
1123494730 15:20814437-20814459 AGGTGCCTGGTGCCCGGTGCCGG - Intergenic
1123551225 15:21383530-21383552 AGGTGCCTGGTGCCCGGTGCCGG - Intergenic
1124848124 15:33311182-33311204 CGGTGCCGGGTGCCCGGTGCCGG + Intronic
1125535834 15:40440989-40441011 GGGCGGCGGGGGCCGGGCTCCGG - Intronic
1126777612 15:52112814-52112836 GGGGGCCGGGGGCCGGGGGCCGG - Intergenic
1128941311 15:71790160-71790182 GGGTGCAGGGGGCATGGTTCTGG - Intergenic
1129321411 15:74777126-74777148 AGGTGCAGGGTGCAGGGTGCAGG - Intergenic
1132481568 16:168856-168878 AGGGGCTGGGGGCTGGGTCCAGG - Intergenic
1132683573 16:1153335-1153357 AGGCGCTGGGGGCCGGGGCCGGG + Exonic
1132683592 16:1153369-1153391 AGGCGCTGGGGGCCGGGGCCGGG + Exonic
1132730004 16:1356504-1356526 AGGGGCCGTGGCCGGGGTTCTGG + Intronic
1132742336 16:1421059-1421081 AGGTGCGCGGGGCCTGGTTGGGG + Intergenic
1135325496 16:21522928-21522950 AGGAGCCGGGGTCAGAGTTCAGG + Intergenic
1136385980 16:29926204-29926226 AGCTGCCCGGCGCCGGCTTCCGG - Exonic
1136540599 16:30925764-30925786 AGCAGCCGGGGGCCGGGGGCCGG + Exonic
1136556480 16:31010463-31010485 CTGTGCCGGAGGCCGGGGTCTGG + Exonic
1136927505 16:34388569-34388591 AGGTGGCGGGGGCGGTGGTCAGG + Intergenic
1136977069 16:35023237-35023259 AGGTGGCGGGGGCGGTGGTCAGG - Exonic
1137562087 16:49509457-49509479 AGGTGCTGGGGGCCGGGCATGGG - Intronic
1138521127 16:57571408-57571430 AGGGGCTGGGGGCCAGGCTCTGG - Intronic
1141531269 16:84648568-84648590 GGGCGGCGGGGCCCGGGTTCAGG - Exonic
1141620341 16:85233982-85234004 AGGGGCTGGGGGGCTGGTTCTGG - Intergenic
1141655869 16:85416296-85416318 AGGGGCCCGGGGCCGGGAGCTGG + Intergenic
1141709459 16:85689290-85689312 AAGAGCCGGGGGTGGGGTTCCGG + Intronic
1142038494 16:87877515-87877537 AGGAGCCGGGGTCAGAGTTCAGG + Intergenic
1142144912 16:88488927-88488949 AGGCGCTGGGCGCCGGGTTGGGG - Intronic
1142245855 16:88969745-88969767 AGGTGCCGGGGGGCAGGTGCTGG + Intronic
1142377254 16:89712347-89712369 AGGTTCCGGGGTCGGGGTACAGG - Intronic
1142696525 17:1636912-1636934 GGGCGCTGGGGGCCGGGGTCTGG - Intronic
1143324278 17:6088271-6088293 GGGTGCCGGGAGCTGGGTGCTGG + Intronic
1143465050 17:7131049-7131071 GGGAGCCGGGAGCTGGGTTCAGG - Intergenic
1144782190 17:17813837-17813859 TGGTGCCAGGGGCCGGCTCCGGG + Intronic
1145993379 17:29092309-29092331 AGGTGCCCGGGGCAGAGCTCGGG - Intronic
1147142472 17:38467094-38467116 AGGGCCCGGGTGCTGGGTTCCGG - Exonic
1149639803 17:58195224-58195246 AGGTGCTGGGGGTGGGGATCTGG + Intronic
1152077573 17:78168804-78168826 AGGTGGCGGCGGCCGCGTCCGGG + Intronic
1152794121 17:82298564-82298586 AGGTGCCCGGGGCCGGGCTCTGG + Intergenic
1160544034 18:79641083-79641105 GGGTGCCGGGGGCCGGGGCAGGG - Intergenic
1160721829 19:600947-600969 GGGTGCCGGGGGCCGGGGGTTGG - Intronic
1160820183 19:1054230-1054252 AGACGCCGTGGGCCGGGTACAGG + Exonic
1161065635 19:2236067-2236089 GGGTGCCGGAGGCCGGAGTCCGG - Intronic
1161137079 19:2626241-2626263 TGGGGCAGGGGGCCGGCTTCAGG - Intronic
1161301091 19:3543607-3543629 GGGTGCTGGGGGCCTGGTACTGG - Exonic
1161962483 19:7530220-7530242 AGGAACCGGGGGCTGGGGTCAGG - Intronic
1161973374 19:7596121-7596143 GGGTGCTGCGGGCCGCGTTCGGG + Exonic
1162727065 19:12696145-12696167 CGGGGCCGGGGGCCGGGGACCGG - Intronic
1162727068 19:12696152-12696174 AGGTGCGCGGGGCCGGGGGCCGG - Exonic
1163577463 19:18118999-18119021 AGGTGCAGGAGGCTGGCTTCAGG + Intronic
1163750957 19:19077369-19077391 AGGTGCCAGGGGCTGGGAGCAGG - Intronic
1163776223 19:19219335-19219357 AGGGGCCGGGGGCCGGGGAGAGG + Intronic
1163828441 19:19536390-19536412 AGGTGACGGAGGCTGGGTGCAGG + Intronic
1165110837 19:33501122-33501144 CGGTGCCGGGTGCTGGGTGCTGG - Intronic
1165236826 19:34428474-34428496 GGTGGCCGGGGGCCGGGTGCTGG + Exonic
1165253627 19:34559363-34559385 GGGTGCCGGGGGAGGGGATCCGG + Intergenic
1165408348 19:35643796-35643818 AGGTGCCTGGGTCCCGGCTCAGG - Intronic
1166727459 19:45037607-45037629 AGGTGCCGGGGCCGTGGTTGGGG + Exonic
1167011909 19:46814059-46814081 AGGTGGCGGGGGCGGGGATGAGG - Intergenic
1167473545 19:49688096-49688118 TGGTGGCGGGGGGCGGGTGCAGG - Intronic
1168594450 19:57664250-57664272 AGGGGTCGGGGGTCGGGGTCGGG + Intergenic
925012687 2:497374-497396 AGATGCCGAGGGCCGGACTCAGG + Intergenic
925940235 2:8810036-8810058 AGGTACCAGGGGACGGCTTCAGG - Intronic
926155025 2:10448686-10448708 AGCTGCCGCGGGCCGGGGCCGGG - Intergenic
926695042 2:15765226-15765248 AGGTGCCTGGGGCTGGGGTCTGG + Intergenic
927638429 2:24832079-24832101 AGGGGCCGGGGGCAGGGGACGGG + Intronic
927896526 2:26786253-26786275 AGGGGCCGGGGGTCGGGGTCGGG - Exonic
931977106 2:67654763-67654785 AGGGGTCGGGGTCCGGGGTCAGG - Intergenic
932215577 2:69963898-69963920 AGGCGCCGGGGGCAGGGGTCTGG + Intergenic
934477632 2:94603870-94603892 AGATGCTGGGGGGCGGGTCCCGG - Exonic
935226978 2:101061305-101061327 AGGTGCCAGGGGACCGGCTCTGG + Intronic
935622816 2:105144072-105144094 AGCTGCCGGGGGCCGGGAGGAGG - Intergenic
938231242 2:129661270-129661292 AGGTGCTGGGGGCCTGAGTCTGG - Intergenic
938392300 2:130915773-130915795 GGGTGCCGGGGGCCGGCAGCTGG + Intronic
940640750 2:156342366-156342388 GGGGGCCGGGGGCCGGGGGCCGG - Intergenic
940640756 2:156342373-156342395 AGCCGCCGGGGGCCGGGGGCCGG - Intergenic
942098502 2:172555996-172556018 CGGCGCAGGGGGCCGGGCTCCGG + Exonic
943932088 2:193867847-193867869 TGGTGCCGGGGGCAGGGAGCAGG - Intergenic
945032998 2:205682524-205682546 ATGTGCTGGGGGCCGGCTGCAGG - Exonic
947122896 2:226835986-226836008 GGGTTCCTGGGGCCGGGTGCGGG - Exonic
947752655 2:232540856-232540878 AGGTGCCGAGGGCAGGGCCCTGG + Intronic
947819203 2:233058987-233059009 AGGTGCTGGGGGCCCTGTTCTGG + Intergenic
947912324 2:233809460-233809482 AGGGGCTGGGGGGCGGGTTGAGG + Intronic
1171958025 20:31474901-31474923 CGGTGCTGGGGGAGGGGTTCGGG - Intronic
1173555735 20:43964312-43964334 AGATGCCGGGGGAGGGGTGCAGG - Intronic
1173741625 20:45406234-45406256 GGGTGCCGGAGGCAGGGTTCGGG + Intronic
1173750290 20:45470587-45470609 AGGTGGGAGGGCCCGGGTTCCGG + Intronic
1174518010 20:51108179-51108201 TAGTGCTGGGGGCTGGGTTCTGG - Intergenic
1175911479 20:62407228-62407250 CGGGGCCGGGGGCCGGGCCCGGG + Exonic
1175927549 20:62478268-62478290 AGGTGCCGGGGCCTCGGTGCGGG + Intergenic
1175929292 20:62486051-62486073 AGGTGCCAGGGGCCAGGTGGGGG - Intergenic
1175931470 20:62495811-62495833 AGGTGCCGGGAGCCCGGGCCGGG - Intergenic
1176025593 20:62983930-62983952 AGGGGCTGGGGGCGGGGTTTGGG - Intergenic
1178541781 21:33457850-33457872 AGGTTCCGGGGGGTGGGTTGGGG - Intronic
1179381214 21:40901099-40901121 AGGGGGCGGGGGCCTGTTTCTGG - Intergenic
1179935836 21:44602822-44602844 AGGTTCCTGGGGCCGAGTCCAGG - Intronic
1179961289 21:44768195-44768217 AGGTTCCTGGGGCCGAGTCCAGG - Intergenic
1180179471 21:46111590-46111612 AGGTGCCAGGGGTCGGGGGCCGG + Exonic
1180179497 21:46111652-46111674 AGGTGCCAGGGGTCGGGGGCCGG + Intronic
1180179523 21:46111714-46111736 AGGTGCCAGGGGTCGGGGGCCGG + Intronic
1180179549 21:46111776-46111798 AGGTGCCAGGGGTCGGGGGCCGG + Intronic
1180245801 21:46546514-46546536 AGGTCCCTGGTGCCGGGTTTGGG + Intronic
1180480573 22:15749644-15749666 AGGTGCTGGGCGCCCGGTGCCGG + Intergenic
1182104951 22:27682646-27682668 AGGGGCTGGTGGCCGGGTCCTGG - Intergenic
1182586346 22:31346171-31346193 CGGTGGCGCGGGCCGGGTCCCGG + Exonic
1183481156 22:38066277-38066299 AGGTGCAGGGGGTCTCGTTCTGG + Intronic
1183586352 22:38755459-38755481 CGCTGCCCGGGGCCGGGTTGGGG + Intronic
1183599212 22:38830334-38830356 GGGTGCCGGGGGCATGGTTTTGG + Intronic
1184554760 22:45227123-45227145 ACCTGCCGTGGGCCGGGTGCTGG - Intronic
1184562152 22:45269387-45269409 AAGTGCAGGGGGTCGGGTTTGGG - Intergenic
1185175182 22:49322410-49322432 AGGTGCAGGGGGCAGGGATGGGG + Intergenic
1185388835 22:50548319-50548341 AGGTACAGGGGGCCTGGTTGAGG + Exonic
950441297 3:13012264-13012286 AGGGGCCTAGGGTCGGGTTCAGG - Intronic
950614408 3:14147690-14147712 AGGAGCCTGGGTCCGGGCTCTGG - Intronic
954823012 3:53347678-53347700 ACGCTCCGGGCGCCGGGTTCCGG + Intergenic
961681477 3:128602968-128602990 AGGTGGCTGGGGCCAGGTTCTGG + Intergenic
962677615 3:137768400-137768422 AAGAGCCGGGGGCCCAGTTCGGG + Intergenic
968459544 4:717747-717769 AGGTGCAGGAGGGCGTGTTCTGG + Intronic
968514841 4:1011702-1011724 CGGGGCCGGGGGCCGGGGCCGGG - Intronic
968590956 4:1459397-1459419 AGGTCCCGGGGGCTGGGCACAGG - Intergenic
968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG + Intronic
968737771 4:2306414-2306436 GGGTGCCGGGGGCCTGGTTGGGG - Intronic
968764158 4:2459408-2459430 ATGTGCCGCGGGCCTGGGTCTGG + Intronic
968820173 4:2844042-2844064 GGGCGGCGGGGGCCCGGTTCGGG + Intronic
968947754 4:3674597-3674619 ATGTGCAGGGGGCTGGGTCCAGG + Intergenic
968961124 4:3744199-3744221 AGGTGCCTGGGGCAGAGTCCAGG + Intergenic
968985279 4:3871531-3871553 AGGTGGTGGGGGCCCGGATCTGG + Intergenic
969460801 4:7327808-7327830 CGTTGCCGGGGGCGGGGTTGGGG - Intronic
969539049 4:7774464-7774486 AGGTGCTGGGGGACCTGTTCCGG - Intronic
969720045 4:8888517-8888539 GGGTGCTGGGTGCCGGGTGCTGG + Intergenic
969720047 4:8888524-8888546 GGGTGCCGGGTGCTGGGTGCTGG + Intergenic
969841965 4:9889282-9889304 AGCTGCCGGGGGCAGGGTGTGGG + Intronic
969873074 4:10116585-10116607 AGGGGCCGGGGACCGGGGCCGGG + Intronic
977140244 4:93362317-93362339 TGTTGCCGGGGGACGGGTTGTGG + Intronic
982023934 4:151233304-151233326 AGGTGCAGAGGGCTGGTTTCAGG - Intronic
985666372 5:1183549-1183571 GGGTGCCGGGTGCCGGGTGCTGG - Intergenic
985666379 5:1183570-1183592 CAGTGCCGGGTGCTGGGTTCTGG - Intergenic
985783782 5:1883854-1883876 AGGGGCCGGGGCCTGGGTTGAGG - Intronic
985784870 5:1888150-1888172 AGGTGGCGGGGGCAGGGTAGGGG - Intergenic
989613005 5:43313295-43313317 AGGTGCCGCGGGCGGGGTGTGGG - Intronic
997634947 5:135398468-135398490 TGGTGCGGGGGACCGGGTTGGGG - Intronic
998093005 5:139381854-139381876 GGGTGGCGGGGGACGGGTTGGGG + Intronic
998184665 5:139968951-139968973 AGGTGCGCGGGTCCGCGTTCAGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001401973 5:171451215-171451237 AGGCGCCGGGGGCCGGGGCCGGG - Intronic
1002526165 5:179817136-179817158 GGGTGGGGTGGGCCGGGTTCGGG + Intronic
1002620802 5:180486853-180486875 AGTTGATGGGGGCCGGGTGCGGG - Intergenic
1002785028 6:393559-393581 GGGGGCCGGGAGCCGGGTCCTGG + Intronic
1003048163 6:2754506-2754528 GGTTGCCGGGGGCTGGGTGCAGG + Intergenic
1003095956 6:3143836-3143858 AGGAGCCAGAGGCCCGGTTCTGG + Intronic
1005968710 6:30744449-30744471 TGGTGGAGGGGGCCGGGGTCGGG + Exonic
1005987692 6:30884595-30884617 AGGAGCCGGGAGCCGGGAGCGGG - Intronic
1006388637 6:33746209-33746231 AGCTGCCTGGGGCCTGGTGCAGG - Intronic
1006457918 6:34142638-34142660 AGGGTCAGGGGGCCGGGTTCAGG - Intronic
1007765469 6:44157219-44157241 AGGTGCCAGGGGTAGGGTGCAGG - Intergenic
1015859063 6:137656537-137656559 CGGGGCCGGGGGGCGGGTTAAGG - Intergenic
1017812138 6:157990971-157990993 AGGTGCTGAGGGCTGGGGTCTGG - Intronic
1018702962 6:166441863-166441885 AGCTGCCGGGGGCCGGGGGCCGG + Intronic
1019148624 6:169989395-169989417 AGGTGCCAGGGGCCTGGTTTGGG - Intergenic
1019388920 7:774361-774383 AGGAGCCGGCGGCCGGGCTGCGG + Intronic
1019421673 7:953883-953905 AGGTGCAGGGAGCCGGGGGCAGG + Intronic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020130498 7:5556334-5556356 AGGGGCCGCGGGCCGGGGGCGGG - Intronic
1021868292 7:24979916-24979938 AGTTCCCCGGGGCCGGGCTCCGG + Exonic
1022207776 7:28180280-28180302 AGGTGCCGGGGGGCGGGGAGCGG - Intronic
1024639295 7:51316633-51316655 TGGTGCCGGGGGCCGGGACGCGG + Exonic
1027372185 7:77518094-77518116 AGGGGACGGGGGTCGGGGTCGGG - Intergenic
1028666375 7:93348207-93348229 AGGTGCCAGAGGCTGGGTACAGG - Intronic
1034441119 7:151086580-151086602 TGGAGCCGGGGGCCGGGGGCCGG - Intronic
1035309890 7:157960166-157960188 AGGGGCCGGGGGAGGGGTTGAGG + Intronic
1035360954 7:158314065-158314087 ATGTGGCGGGGGCAGGGTGCCGG - Intronic
1035652911 8:1282210-1282232 TGGTTCAGGGGGCTGGGTTCAGG - Intergenic
1036701699 8:11017549-11017571 AGCTGCCTGTGGCTGGGTTCCGG + Intronic
1039903275 8:41767699-41767721 AGGTGCCGGCCGGCGGGCTCGGG + Intronic
1041313317 8:56538088-56538110 AGATGCCGGGTGCAGGGTTCAGG + Intergenic
1041413018 8:57577385-57577407 AGGTGCAGGGTGCCGGCTGCTGG - Intergenic
1041721958 8:60984055-60984077 AGGTGCTGGGGGCAGGGTCAGGG - Intergenic
1042040283 8:64581789-64581811 AGGCGCCGAGCGCCGGGTGCAGG - Exonic
1042591525 8:70402862-70402884 GGGAGCCGGGGGCCGGGCCCCGG - Intronic
1044233788 8:89807726-89807748 AGGTGGCTGAGGCCGGGTTTGGG - Intergenic
1047182626 8:122604093-122604115 AAGCGCTGGGGGCCGGGGTCAGG - Intergenic
1047454704 8:124998454-124998476 AGGGACCGGGGGCGGGGCTCAGG - Intergenic
1048395612 8:134011310-134011332 AGGTGCAGGGGGCGGGGCTCTGG + Intergenic
1048963209 8:139596940-139596962 AGGTGCAGGGGCCTGGGTTATGG - Intergenic
1049531942 8:143159418-143159440 AGGGGCCGAGGGCCGGGCTGGGG + Intronic
1049551466 8:143261849-143261871 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1049551500 8:143261973-143261995 AGGTGCAGGGGTGCGGGTGCGGG - Intronic
1051445589 9:17135602-17135624 AGGGGCAGGGGCCCGGGTTTGGG - Intronic
1052859743 9:33430149-33430171 AGTTGCCGGGGGCAGGATTGGGG - Intergenic
1053157775 9:35792246-35792268 AGGTGCTGGGGGCCGGGGAGAGG - Exonic
1057203895 9:93159212-93159234 AGGAGCCAGGAGCCAGGTTCTGG - Intergenic
1057600201 9:96450682-96450704 GGGTCCCGGGGGCCGGTTTCAGG + Intronic
1059305353 9:113349602-113349624 CGGGGCCGGGGTCCGGGTCCGGG + Exonic
1060856085 9:126915396-126915418 AGGTGCGGGGGGCGGGGCCCGGG + Intronic
1061145034 9:128792582-128792604 GGGTGCCTGGGGCCGGGAGCTGG + Intronic
1061575438 9:131503190-131503212 CGGAGCTGGGGGCGGGGTTCGGG + Intronic
1061840569 9:133356523-133356545 TGGAGCCGGGGGCGGGGCTCTGG - Intronic
1062022661 9:134326687-134326709 CGGGGCCGGGGGCCGGGGGCCGG + Intronic
1062344071 9:136106863-136106885 AGGTGCCGGGGGCTGGCTGCAGG - Intergenic
1062398552 9:136362558-136362580 TGGTGCCGGGAGCCTGGTCCGGG - Intronic
1062657954 9:137613872-137613894 AGGTGAGGGGGGCCAGGGTCTGG + Intronic
1203759152 EBV:3031-3053 AGATGCACGGGGCCGGGTACAGG - Intergenic
1188974561 X:36657520-36657542 AGGGGCCGGGGGCCAGGGGCTGG + Intergenic
1189340288 X:40199967-40199989 AGGTGCAGGGGGCCGGGGGCTGG - Intergenic
1196655503 X:118213550-118213572 AGGTGAAGGGGGCCAGGTGCAGG + Intergenic
1200000104 X:153055995-153056017 AGGGTCAGGGAGCCGGGTTCTGG - Intergenic
1200003026 X:153071960-153071982 AGGGTCAGGGAGCCGGGTTCTGG - Intergenic
1200004697 X:153078049-153078071 AGGGTCAGGGAGCCGGGTTCTGG + Intergenic