ID: 968699927

View in Genome Browser
Species Human (GRCh38)
Location 4:2050366-2050388
Sequence CTTATTATCAGATTTCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968699927_968699931 12 Left 968699927 4:2050366-2050388 CCTGACTGAAATCTGATAATAAG No data
Right 968699931 4:2050401-2050423 ATTTTTTTTTAAGAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968699927 Original CRISPR CTTATTATCAGATTTCAGTC AGG (reversed) Intergenic
No off target data available for this crispr