ID: 968701456

View in Genome Browser
Species Human (GRCh38)
Location 4:2059920-2059942
Sequence GGGAGCTCCGCGCCGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968701456_968701467 10 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701467 4:2059953-2059975 GTCCACGCGGACCCCGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 89
968701456_968701477 29 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701477 4:2059972-2059994 CCGGCTCCCGGGGACCAGCCTGG 0: 1
1: 0
2: 5
3: 21
4: 268
968701456_968701460 -3 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701460 4:2059940-2059962 CCCCCGCCCCGGCGTCCACGCGG 0: 1
1: 0
2: 1
3: 22
4: 215
968701456_968701470 18 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701470 4:2059961-2059983 GGACCCCGCGCCCGGCTCCCGGG 0: 1
1: 0
2: 7
3: 40
4: 370
968701456_968701471 19 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701471 4:2059962-2059984 GACCCCGCGCCCGGCTCCCGGGG 0: 1
1: 0
2: 2
3: 47
4: 268
968701456_968701478 30 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701478 4:2059973-2059995 CGGCTCCCGGGGACCAGCCTGGG 0: 1
1: 0
2: 1
3: 20
4: 169
968701456_968701469 17 Left 968701456 4:2059920-2059942 CCTCGGGCCGGCGCGGAGCTCCC 0: 1
1: 0
2: 3
3: 25
4: 196
Right 968701469 4:2059960-2059982 CGGACCCCGCGCCCGGCTCCCGG 0: 1
1: 0
2: 3
3: 44
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968701456 Original CRISPR GGGAGCTCCGCGCCGGCCCG AGG (reversed) Intronic
900169369 1:1258841-1258863 GGCAGCCCCGCCCCAGCCCGAGG + Intronic
900237703 1:1600436-1600458 TGCAGCTCCGCGACCGCCCGTGG + Intergenic
900545783 1:3228494-3228516 GGGAGCTCTGGGCCAGCCCCAGG + Intronic
900989449 1:6091565-6091587 CTGAGCTCCGCGGCGGCCGGGGG + Intronic
901065027 1:6490405-6490427 GGGAGCTGCGCTCCGGACGGGGG - Intronic
902468231 1:16630991-16631013 CGGCGCTCCTCGCCGGGCCGAGG - Intergenic
903435222 1:23344188-23344210 GTGAGTCTCGCGCCGGCCCGTGG - Intronic
903448487 1:23437242-23437264 GGGAGCCCAGCGCTGGCCCGGGG - Exonic
904006658 1:27366560-27366582 GCGCGCTCCGCCCCGGACCGGGG + Exonic
905912177 1:41662481-41662503 GGGACCCCGCCGCCGGCCCGGGG + Intronic
908360926 1:63367758-63367780 GCCAGCTCTGCGCCGGCTCGTGG - Intronic
908401326 1:63774702-63774724 CGGAGCCCCGCGGCGGGCCGGGG + Intronic
909433529 1:75615926-75615948 GGGAGCTGCGCGGCAGCCGGAGG - Intergenic
912486682 1:110034743-110034765 AGGAGGCCCGCGGCGGCCCGCGG - Exonic
912561615 1:110555495-110555517 GGGAGCTCCGCGGGGACGCGGGG - Intergenic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
913209454 1:116570862-116570884 AGGGGCCCCGCGCCGGCCGGCGG - Intronic
919757555 1:201075371-201075393 GGGAGCTCCCCTCCAGCCAGAGG + Intronic
919929944 1:202214502-202214524 GGGAGCTAAGCGGCGGCCCCGGG - Intronic
922461400 1:225816813-225816835 GGGAGCCCCGAGCCAGCCCGCGG - Intronic
924172438 1:241356755-241356777 GGGAGCCCCGCGCCGGGGCTGGG - Intronic
1070768143 10:79068151-79068173 GGGCGCTCCGCGCCGGGCCTAGG + Intergenic
1071544821 10:86521426-86521448 GAGGGTTCCGCGCCCGCCCGCGG - Exonic
1072521247 10:96231860-96231882 GGGGGCTCAGCGCATGCCCGTGG - Intronic
1073812297 10:107164461-107164483 GCGCGCTCCTCGCCGGCGCGGGG - Exonic
1075587114 10:123666190-123666212 GGGAGCCCCGCGCCGCCTCACGG - Intergenic
1076372280 10:129963554-129963576 AGGAGCGCGGCGCCGGCCGGCGG + Intronic
1076537231 10:131187491-131187513 GGGAGATGGGCGCCGGCCCTGGG - Intronic
1076690725 10:132222785-132222807 GGGTGCTGAGCCCCGGCCCGTGG + Intronic
1083842880 11:65314825-65314847 CGCAGCCCCGCCCCGGCCCGCGG - Exonic
1083944992 11:65918847-65918869 GGGAGCACAGCTCGGGCCCGTGG - Intronic
1084019475 11:66409218-66409240 GCGAGCCCCGCGCCGGGCCGGGG + Intergenic
1084128709 11:67118245-67118267 GCGGTCTCCGCGACGGCCCGGGG - Intergenic
1084165582 11:67373420-67373442 GGGAGCCCCGCGCCGGGGCCGGG - Intronic
1084517295 11:69643781-69643803 GGGAGGTGCGGGCCAGCCCGGGG - Intronic
1084621126 11:70270867-70270889 GGAGGCTCCGCGGCGGCTCGCGG - Exonic
1085334269 11:75679066-75679088 GGCAGCTCAGTGCGGGCCCGCGG - Intergenic
1086455325 11:86954974-86954996 CGAAGCCCCGCGCCGGCCCCAGG + Exonic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1094465984 12:30754612-30754634 GGGAGCCCCGCCCCGCCCCGGGG + Intronic
1097195743 12:57241707-57241729 GGGACCTGCTCTCCGGCCCGCGG + Intergenic
1100830944 12:98516115-98516137 GGCTGCTCGGCTCCGGCCCGCGG - Exonic
1101716818 12:107319280-107319302 GGGACCGCCGGGCCTGCCCGGGG - Exonic
1102197116 12:111033885-111033907 GGGAGCTCGGCGCCCGCCCGGGG - Intergenic
1102438176 12:112941577-112941599 GAGAGCTGTGCCCCGGCCCGAGG - Exonic
1102469836 12:113153430-113153452 GGGAGCTCGGCGCCACCGCGTGG + Intronic
1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG + Intergenic
1103509712 12:121466558-121466580 GGGTGGCCCGCGCCGGCCCGCGG + Intronic
1103565265 12:121812121-121812143 GGAAGCTCCGGGCCGGCCCGCGG + Intronic
1105074528 12:133264222-133264244 AGGCGCCCCGCGCCGGCGCGGGG - Intergenic
1105943437 13:25170776-25170798 GGCAGCTCCGCGCTGGGGCGCGG + Exonic
1106248361 13:27966902-27966924 AGGAGCCCGGCTCCGGCCCGCGG + Intronic
1110609828 13:77475725-77475747 CGGAGCTGCCCGCCGGCCAGCGG - Intergenic
1117424489 14:55580443-55580465 GGGAGGGCCGCGCCGGGCGGGGG + Intronic
1118610028 14:67532965-67532987 GAGAGCTCCGGGCCGGCGCCCGG + Intronic
1119505909 14:75172983-75173005 GGGAGCTCCCGGCCCACCCGAGG - Intronic
1122470918 14:101965177-101965199 GGGGGCTCCGGGCCGGGCAGTGG - Intronic
1122624255 14:103075951-103075973 GTGAGTCCCGCGCCCGCCCGGGG - Intergenic
1123039948 14:105486398-105486420 GGCATCTCCGAGCCGGCCTGGGG + Intergenic
1125999411 15:44195123-44195145 GGCAGCTCCGCACCGACCCCAGG + Exonic
1126467676 15:48975876-48975898 GGGGGCGCTGCGCCTGCCCGCGG - Intergenic
1128149775 15:65355611-65355633 CGCAGCTGCGCCCCGGCCCGCGG + Intronic
1128322545 15:66703444-66703466 GGTAGCCCCGCGGCGGCCCCGGG + Exonic
1129675971 15:77632619-77632641 GGCGGCTCCGGGCCGGCCCAGGG - Intronic
1129843855 15:78759355-78759377 GGGAGCTCCGCCACAGCCCGTGG + Exonic
1130257954 15:82334445-82334467 GGGAGCTCCGCCACAGCCCGTGG - Intergenic
1130596980 15:85255518-85255540 GGGAGCTCCGCCACAGCCCGTGG + Intergenic
1131272808 15:90957197-90957219 CGGTGCTGCGCGCCGGGCCGGGG + Exonic
1131493515 15:92882901-92882923 CGTAGCTCCCCGCCGGCCGGCGG - Intergenic
1131799272 15:96053013-96053035 GGCAGCCCCGCGCTGGCCCCGGG + Intergenic
1132186576 15:99806561-99806583 GGGAGCTGCGCGGCGGCCTCGGG - Intergenic
1132429110 15:101746150-101746172 GGGAGCTGCGCGGCGGCCTCGGG + Intergenic
1132522263 16:397254-397276 GGGGGCTGCGCTGCGGCCCGCGG + Exonic
1132527828 16:426214-426236 TGGAGCGCCGGGCCGGCCCCGGG + Exonic
1132538384 16:495265-495287 GGGGGCTCTGCCCCGGCCCTGGG - Intronic
1132766309 16:1536103-1536125 GGGAGTTCCCAGCCGGCCCTTGG + Intronic
1132778912 16:1612456-1612478 CGCAGCCGCGCGCCGGCCCGCGG + Intronic
1132779507 16:1614793-1614815 GGGCCGTCGGCGCCGGCCCGGGG - Exonic
1132889320 16:2196274-2196296 GGGGGCTCCGCGCCGGGGAGGGG + Intronic
1132891491 16:2207017-2207039 GGGACCTGCGGGCCGGGCCGGGG - Exonic
1132915359 16:2340850-2340872 GGGGGCACCGCGCAGGCGCGGGG - Intergenic
1133024205 16:2980600-2980622 GGATTCTCCGCGCTGGCCCGGGG + Intergenic
1133304884 16:4802574-4802596 GGGCGCTCGGCGGCGGCCTGCGG - Exonic
1133738730 16:8635241-8635263 TGGAGCTCGGGGCCGGCACGGGG + Exonic
1134492243 16:14703728-14703750 GGAAGGTCCCCGCCGGCCCGAGG + Intergenic
1134497624 16:14742850-14742872 GGAAGGTCCCCGCCGGCCCGAGG + Intronic
1136152980 16:28364507-28364529 GGAAGGCCCCCGCCGGCCCGAGG - Intergenic
1136210103 16:28750766-28750788 GGAAGGCCCCCGCCGGCCCGAGG + Intergenic
1137783127 16:51114531-51114553 TGGAGCTCCGGGCCTGCCCCTGG - Intergenic
1137787752 16:51151885-51151907 GGGCGAGGCGCGCCGGCCCGCGG + Intergenic
1139920156 16:70454721-70454743 GGGAGCACCGAGTCGACCCGCGG + Intronic
1140048852 16:71462054-71462076 GGGAGCAGGGCGGCGGCCCGGGG - Exonic
1142132511 16:88437413-88437435 AGGGGCTCCCCGCCGGCCCAGGG - Exonic
1142631461 17:1229054-1229076 GGGGGCTGCGCGCCCGCTCGCGG + Intergenic
1144816694 17:18039903-18039925 GTGAGCGCCGGGCCGGGCCGGGG + Intronic
1147041878 17:37725790-37725812 GGGAGCTCCGCCCCCTCCCTGGG - Intronic
1147400570 17:40178067-40178089 GGGAGCCCCCCGCCGAGCCGGGG + Intronic
1148855308 17:50575945-50575967 TGGATCTCCGGGCTGGCCCGGGG - Exonic
1150336473 17:64334222-64334244 GAGAGCTGGGCGCTGGCCCGGGG - Intronic
1150675893 17:67245534-67245556 AGCAGCTCCGCGCCGCGCCGCGG - Intronic
1150692719 17:67378728-67378750 GGGAGCTGCGCCCAAGCCCGCGG - Intronic
1151586027 17:75009038-75009060 GGGAGCTCCTCCCCGCCCCCCGG + Intergenic
1152288274 17:79424719-79424741 TGGAGCTCCGGCCCGGCCCGAGG - Intronic
1152320994 17:79608854-79608876 GGGAGCTCCTCGCCCGCAGGAGG + Intergenic
1152344225 17:79741803-79741825 GGGAGCTGCCCGCAGGCCCTGGG + Exonic
1152432983 17:80260135-80260157 GAGCGCTCCGCGCGGGGCCGCGG + Intergenic
1153024052 18:657746-657768 GGCAGCTCCGAGCCGGCCACAGG - Exonic
1154501370 18:14999462-14999484 GGGAGGTGCGCAGCGGCCCGCGG + Intergenic
1157338233 18:46756728-46756750 GGGAGCTCTGCCGCGGCCAGGGG + Exonic
1159511527 18:69401894-69401916 GTGTGCCCCGCGCCCGCCCGCGG + Intronic
1161101869 19:2425494-2425516 GTGAGCCCCGCCCCGGCCCAGGG + Intronic
1161333843 19:3700479-3700501 GGGCGCGCCGGGCCGGCGCGGGG + Exonic
1162744127 19:12789702-12789724 GGCAGGTCCCCGCCTGCCCGCGG - Intronic
1163462646 19:17448289-17448311 AGGAGCTGGGCGCCGGCCCCGGG - Exonic
1163782700 19:19258638-19258660 GGGAGCCCTGCGGCGGCCTGGGG - Exonic
1166039096 19:40191550-40191572 GGGCGCGCCACCCCGGCCCGGGG + Intergenic
1166108354 19:40608534-40608556 GGAAGCTCAGGGCCGGGCCGGGG - Exonic
1166685376 19:44793398-44793420 GGGAGCTCCTCGTTGGCCCAAGG + Intronic
1166688297 19:44808954-44808976 GGGAGGTCCGCTCCGGGCAGTGG + Intergenic
1167271460 19:48508895-48508917 AGGAGCTCCGAGCCAGCGCGGGG - Exonic
1167333805 19:48872624-48872646 GGGAGCTGCGCGTCACCCCGGGG - Exonic
1167739028 19:51312747-51312769 GGGAGGGCCGGGCCGGGCCGGGG - Intronic
1168065487 19:53917371-53917393 GGGAGCTGAGTGCCGGCCCCAGG - Intronic
927787087 2:25981762-25981784 GGAACCCCCGCGCCGCCCCGGGG - Exonic
927809371 2:26173116-26173138 GCGAGCGCCGCGGCGGCCCCGGG + Exonic
933858479 2:86441570-86441592 GGGAGCTGGGCGCCGGGGCGGGG + Intronic
936038282 2:109129478-109129500 GCGGGCTCCACGCCGGCCCCGGG + Intronic
938500548 2:131829653-131829675 GGGAGGTGCGCGGCGGCCCGCGG + Intergenic
941111555 2:161423317-161423339 GGGACCTCCGCGCCACCCCTCGG + Intronic
1168965236 20:1894721-1894743 GCGAGCTGCGCGCCCGGCCGGGG - Intronic
1169048652 20:2558510-2558532 CTGAGCTCCGCGCCTGCCTGGGG - Exonic
1171972529 20:31573169-31573191 TGGAGCCAGGCGCCGGCCCGGGG - Intronic
1172618684 20:36306350-36306372 TGGGGCGCCGCGCCGGCCGGAGG + Exonic
1174386055 20:50189326-50189348 AGGAGCTCCCAGCCTGCCCGGGG - Intergenic
1175108230 20:56629226-56629248 TGGGCCTCCGCGCCGGCCCCCGG + Intergenic
1175846658 20:62063400-62063422 GGGAGCTCCTCCCCGGCCTGTGG - Intronic
1176048074 20:63102861-63102883 GGGAGCTGCGGGCCGCTCCGGGG + Intergenic
1176380795 21:6111320-6111342 GGGGGCTCCGCGCGGGCGCCGGG + Intronic
1178555663 21:33588361-33588383 GGGGGCTCCGCGGCGACCCGCGG + Exonic
1179742677 21:43426920-43426942 GGGGGCTCCGCGCGGGCGCCGGG - Intronic
1180110186 21:45643823-45643845 GGCCTCTCCCCGCCGGCCCGCGG + Exonic
1180622478 22:17171480-17171502 GGGAGCTCTGTGCCGTCCCGCGG + Intergenic
1181966384 22:26658934-26658956 GGGAGCCCCGCGATGGCCCAGGG + Intergenic
1182122846 22:27798379-27798401 GGGAGCCCCACGCCCGCCCCGGG + Exonic
1184411961 22:44331091-44331113 GGGCGCACCGCGCCGGGACGCGG - Intergenic
1184481892 22:44752789-44752811 GGAGGCTGCGCGCCGGCCGGAGG - Intronic
1185130475 22:49035926-49035948 GGGGGCTCCATGCTGGCCCGTGG - Intergenic
1185258336 22:49848763-49848785 AGCAGCTCCACGCGGGCCCGGGG + Intergenic
1185330803 22:50251328-50251350 GCGAGCTCCGCCCCGGAGCGAGG + Exonic
1185344990 22:50307187-50307209 GGGCGCTCCGGGCCGGCCCCAGG - Intronic
950429643 3:12943534-12943556 GGGACCTCCACCCCGGCCCGTGG - Intronic
952241347 3:31533400-31533422 CGGGGCTCCGCGGCGGCGCGGGG - Intronic
953680715 3:45036096-45036118 GGGACCTCCTCCCCGCCCCGCGG - Intergenic
954156138 3:48685869-48685891 GGGAGCGCCGAGCCGCGCCGCGG + Exonic
954778948 3:53045588-53045610 GGGAGCGCGGCGCCCGCGCGCGG - Intronic
955688028 3:61563934-61563956 TGGAGCTCCGTGCCGCTCCGCGG - Intronic
956659389 3:71583309-71583331 GGGGGCTGCGGGCCGGCGCGCGG - Intronic
960994739 3:123333419-123333441 GGGAGCTCCAGGCCGGGCCCTGG - Intronic
961652775 3:128425647-128425669 GGGAGCACCGCGCCTGGCCTGGG - Intergenic
962331962 3:134486181-134486203 GCGTGCGCAGCGCCGGCCCGAGG + Intronic
964482844 3:157159756-157159778 AGGAGCGCCCGGCCGGCCCGGGG + Intronic
966355125 3:179071715-179071737 GGGGGCTCGGCGGCGGCCGGCGG - Exonic
968230696 3:197003172-197003194 GGAAGGGCCGCGCGGGCCCGGGG + Exonic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
968908755 4:3466223-3466245 GGAAGTTCCGCGCCTGCCCCCGG + Intronic
969330336 4:6470981-6471003 CGGAGCCCCGCGGAGGCCCGGGG - Intronic
969514156 4:7637309-7637331 GGGAACTCAGGGCAGGCCCGAGG - Intronic
969559609 4:7939067-7939089 TGGGGCTCTGCGCCGCCCCGTGG - Exonic
971294494 4:25376955-25376977 GGGAGCCGCGCGCCGGACCCAGG - Intergenic
974047345 4:56908606-56908628 CGCAGCCCCGCGCCGGCCCGCGG + Intronic
975139203 4:70902691-70902713 GAGCGCTCCGCGCAGTCCCGGGG - Intronic
976765189 4:88591982-88592004 GGAAGCGCGGCGCCGGCCCGCGG - Intronic
978490093 4:109302879-109302901 GGGTTCCCCGGGCCGGCCCGCGG - Intergenic
980930062 4:139176704-139176726 GCGCGCTGCGCGCCTGCCCGCGG - Intronic
984992758 4:185396782-185396804 GGGACTTCCGGGCCGGCCCTTGG - Exonic
985300755 4:188486761-188486783 GGCAGCTCCTCTCAGGCCCGAGG - Intergenic
987258434 5:16179999-16180021 GTGAGCGCGGGGCCGGCCCGTGG - Intronic
993901232 5:93585184-93585206 GGGCGCTCCGGGCTGGCCCGGGG - Exonic
999375103 5:151081110-151081132 GCGCGCTCCGGGCGGGCCCGCGG + Intronic
1001906670 5:175478800-175478822 GGGACCCCCCCCCCGGCCCGAGG - Intronic
1002029405 5:176416673-176416695 GGAAGCGCCGCGCCGGTCCCGGG - Intergenic
1002046273 5:176543290-176543312 GGGAGCGACGCGCCGGCCGCCGG - Intronic
1003074616 6:2971939-2971961 GTGAGCCCCGCGCCCGCCCCTGG - Intronic
1003112174 6:3259371-3259393 GGGAGCTGCGCGCGGGCCCCGGG + Intronic
1007610110 6:43143658-43143680 GGGAGCTGAGCGCCCTCCCGCGG + Intronic
1007765027 6:44155076-44155098 GAGAGCCCCGAGCCGGCCCCGGG + Exonic
1008894988 6:56542702-56542724 GGGAGCTCCGGGGCTGTCCGCGG + Intronic
1013993397 6:116279588-116279610 GGGAGTACCGCCACGGCCCGCGG + Exonic
1016127869 6:140428134-140428156 GGGAGCTCCCCTCTGGCCCAAGG + Intergenic
1016936293 6:149451258-149451280 GGGACCCCCGCGCCGGCGGGAGG + Exonic
1017880538 6:158559951-158559973 TGGGGCTCCGCCCCGGCACGGGG + Intronic
1019301418 7:305981-306003 GGGAGGTCCGCGCCTGCAAGGGG - Intergenic
1019681921 7:2355177-2355199 GGCAGCTCCTCGGCGGCCGGCGG - Exonic
1019686602 7:2385277-2385299 GGGAGCTCCCCGCTGGGCAGGGG + Intergenic
1019828346 7:3301658-3301680 GGGATCCCCGCGGCCGCCCGGGG - Exonic
1019914394 7:4123463-4123485 GGGAGCTCTGTGCAGGCCCAGGG + Intronic
1022339822 7:29457389-29457411 GGGAGCTCTGAGACGGCCTGGGG - Intronic
1022714954 7:32891290-32891312 CGGAGCTCCGGGCAGGTCCGCGG - Intronic
1024043838 7:45574491-45574513 GCGCGCCCCTCGCCGGCCCGGGG - Intronic
1026765064 7:73155105-73155127 GGGAGCTCGGCGCCGGGCGCGGG - Intergenic
1026909361 7:74083612-74083634 GGGCGCGCCGCGCCAGCTCGCGG + Intronic
1027041537 7:74964860-74964882 GGGAGCTCGGCGCCGGGCGCGGG - Exonic
1027082105 7:75237509-75237531 GGGAGCTCGGCGCCGGGCGCGGG + Intergenic
1033220590 7:139524228-139524250 GGGAGCGCGGCGCCGGGACGCGG + Intronic
1034147175 7:148883946-148883968 GTGAGCTTCGGGCTGGCCCGCGG - Intronic
1035496817 7:159335247-159335269 AGGCGCCCCGCGCCGGCGCGGGG - Intergenic
1036910384 8:12754079-12754101 GGGAGCTCCGCGCGGGCGCCCGG - Intronic
1038041431 8:23727087-23727109 TGGAGCTCCGCGCAGGCCGGGGG + Intergenic
1040038957 8:42897200-42897222 GGGGTCTTCCCGCCGGCCCGCGG - Intronic
1041726590 8:61023714-61023736 GGAGGCTGCGCGCCGGCCCCAGG + Intergenic
1047381933 8:124372299-124372321 GCGAGAGCCGCGCGGGCCCGCGG - Exonic
1049369552 8:142257349-142257371 AGGAGCTCCCCGCAAGCCCGAGG + Intronic
1049426435 8:142539944-142539966 GGAAGCTCAGCACCGGCCGGGGG - Intronic
1049807560 8:144547841-144547863 CCAAGCTGCGCGCCGGCCCGCGG - Exonic
1049988558 9:972770-972792 GGGCGCTCCCCGCTGGGCCGCGG - Intergenic
1052970149 9:34372427-34372449 GGCAGCGCCGGGCCGGGCCGTGG - Exonic
1055321673 9:75088495-75088517 GAGTGCTCCGCCCCGCCCCGCGG - Intergenic
1057259624 9:93576531-93576553 GGGAGCCGCCCGCCGGCCCGCGG - Exonic
1060296513 9:122347093-122347115 GGGAACTCCCTGCCGGGCCGCGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061129912 9:128702951-128702973 GGGAGGGGCGCGCGGGCCCGGGG + Intronic
1061134328 9:128724431-128724453 GGGAGCTACGCGCATGCGCGAGG - Intergenic
1062230793 9:135480293-135480315 GGGAGCTTTGGCCCGGCCCGGGG + Intronic
1062413926 9:136438693-136438715 GGGGGCTCCGCGGCCGGCCGGGG + Exonic
1200068867 X:153518077-153518099 GGGCGCTGCCCGCCGGCCTGGGG - Intronic