ID: 968701490

View in Genome Browser
Species Human (GRCh38)
Location 4:2060011-2060033
Sequence TGCCGCGCCGGGCCCCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 287}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968701480_968701490 9 Left 968701480 4:2059979-2060001 CCGGGGACCAGCCTGGGAAGCCC 0: 1
1: 0
2: 5
3: 47
4: 367
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701474_968701490 22 Left 968701474 4:2059966-2059988 CCGCGCCCGGCTCCCGGGGACCA 0: 1
1: 0
2: 1
3: 26
4: 240
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701481_968701490 2 Left 968701481 4:2059986-2060008 CCAGCCTGGGAAGCCCCCCGCTT 0: 1
1: 0
2: 3
3: 26
4: 190
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701475_968701490 17 Left 968701475 4:2059971-2059993 CCCGGCTCCCGGGGACCAGCCTG 0: 1
1: 0
2: 2
3: 39
4: 389
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701473_968701490 23 Left 968701473 4:2059965-2059987 CCCGCGCCCGGCTCCCGGGGACC 0: 1
1: 0
2: 3
3: 38
4: 337
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701482_968701490 -2 Left 968701482 4:2059990-2060012 CCTGGGAAGCCCCCCGCTTTCTG 0: 1
1: 0
2: 1
3: 9
4: 170
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701472_968701490 24 Left 968701472 4:2059964-2059986 CCCCGCGCCCGGCTCCCGGGGAC 0: 1
1: 0
2: 3
3: 43
4: 303
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701476_968701490 16 Left 968701476 4:2059972-2059994 CCGGCTCCCGGGGACCAGCCTGG 0: 1
1: 1
2: 3
3: 33
4: 334
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287
968701479_968701490 10 Left 968701479 4:2059978-2060000 CCCGGGGACCAGCCTGGGAAGCC 0: 1
1: 0
2: 4
3: 49
4: 440
Right 968701490 4:2060011-2060033 TGCCGCGCCGGGCCCCGCGCAGG 0: 1
1: 0
2: 1
3: 29
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968701490 Original CRISPR TGCCGCGCCGGGCCCCGCGC AGG Intronic