ID: 968702100

View in Genome Browser
Species Human (GRCh38)
Location 4:2062093-2062115
Sequence AGCAACACAGGGGGCTCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 1208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968702088_968702100 22 Left 968702088 4:2062048-2062070 CCTCTGCTTGGGAGGGGAAACGG No data
Right 968702100 4:2062093-2062115 AGCAACACAGGGGGCTCCGGTGG 0: 1
1: 0
2: 0
3: 38
4: 1208
968702087_968702100 26 Left 968702087 4:2062044-2062066 CCAGCCTCTGCTTGGGAGGGGAA 0: 1
1: 0
2: 3
3: 23
4: 276
Right 968702100 4:2062093-2062115 AGCAACACAGGGGGCTCCGGTGG 0: 1
1: 0
2: 0
3: 38
4: 1208
968702093_968702100 -2 Left 968702093 4:2062072-2062094 CCATGAGGAAGCACAGGCCACAG 0: 1
1: 1
2: 8
3: 52
4: 384
Right 968702100 4:2062093-2062115 AGCAACACAGGGGGCTCCGGTGG 0: 1
1: 0
2: 0
3: 38
4: 1208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968702100 Original CRISPR AGCAACACAGGGGGCTCCGG TGG Intronic