ID: 968703764

View in Genome Browser
Species Human (GRCh38)
Location 4:2068967-2068989
Sequence CTCGCTCGCCCCCACCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968703764_968703771 -8 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703771 4:2068982-2069004 CGAGCGAGTTCTGAGGAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
968703764_968703779 8 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703779 4:2068998-2069020 AGAGGGGCTGCGGGGGCCGGGGG 0: 1
1: 1
2: 6
3: 92
4: 821
968703764_968703775 1 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703775 4:2068991-2069013 TCTGAGGAGAGGGGCTGCGGGGG 0: 1
1: 1
2: 2
3: 43
4: 488
968703764_968703770 -9 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703770 4:2068981-2069003 GCGAGCGAGTTCTGAGGAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 78
968703764_968703777 6 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703777 4:2068996-2069018 GGAGAGGGGCTGCGGGGGCCGGG 0: 1
1: 1
2: 14
3: 160
4: 1181
968703764_968703769 -10 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703769 4:2068980-2069002 GGCGAGCGAGTTCTGAGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 111
968703764_968703781 12 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703781 4:2069002-2069024 GGGCTGCGGGGGCCGGGGGTGGG 0: 1
1: 0
2: 21
3: 195
4: 1660
968703764_968703776 5 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703776 4:2068995-2069017 AGGAGAGGGGCTGCGGGGGCCGG 0: 1
1: 1
2: 10
3: 146
4: 1104
968703764_968703780 11 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703780 4:2069001-2069023 GGGGCTGCGGGGGCCGGGGGTGG 0: 1
1: 2
2: 46
3: 436
4: 3145
968703764_968703772 -2 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703772 4:2068988-2069010 AGTTCTGAGGAGAGGGGCTGCGG 0: 1
1: 0
2: 3
3: 58
4: 544
968703764_968703773 -1 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703773 4:2068989-2069011 GTTCTGAGGAGAGGGGCTGCGGG 0: 1
1: 0
2: 4
3: 39
4: 383
968703764_968703778 7 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703778 4:2068997-2069019 GAGAGGGGCTGCGGGGGCCGGGG 0: 1
1: 1
2: 9
3: 98
4: 930
968703764_968703774 0 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703774 4:2068990-2069012 TTCTGAGGAGAGGGGCTGCGGGG 0: 1
1: 0
2: 4
3: 27
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968703764 Original CRISPR CTCGCTCGCCCCCACCCTGG GGG (reversed) Exonic