ID: 968703764

View in Genome Browser
Species Human (GRCh38)
Location 4:2068967-2068989
Sequence CTCGCTCGCCCCCACCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968703764_968703777 6 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703777 4:2068996-2069018 GGAGAGGGGCTGCGGGGGCCGGG 0: 1
1: 1
2: 14
3: 160
4: 1181
968703764_968703776 5 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703776 4:2068995-2069017 AGGAGAGGGGCTGCGGGGGCCGG 0: 1
1: 1
2: 10
3: 146
4: 1104
968703764_968703774 0 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703774 4:2068990-2069012 TTCTGAGGAGAGGGGCTGCGGGG 0: 1
1: 0
2: 4
3: 27
4: 318
968703764_968703770 -9 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703770 4:2068981-2069003 GCGAGCGAGTTCTGAGGAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 78
968703764_968703772 -2 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703772 4:2068988-2069010 AGTTCTGAGGAGAGGGGCTGCGG 0: 1
1: 0
2: 3
3: 58
4: 544
968703764_968703775 1 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703775 4:2068991-2069013 TCTGAGGAGAGGGGCTGCGGGGG 0: 1
1: 1
2: 2
3: 43
4: 488
968703764_968703781 12 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703781 4:2069002-2069024 GGGCTGCGGGGGCCGGGGGTGGG 0: 1
1: 0
2: 21
3: 195
4: 1660
968703764_968703771 -8 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703771 4:2068982-2069004 CGAGCGAGTTCTGAGGAGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
968703764_968703780 11 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703780 4:2069001-2069023 GGGGCTGCGGGGGCCGGGGGTGG 0: 1
1: 2
2: 46
3: 436
4: 3145
968703764_968703779 8 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703779 4:2068998-2069020 AGAGGGGCTGCGGGGGCCGGGGG 0: 1
1: 1
2: 6
3: 92
4: 821
968703764_968703773 -1 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703773 4:2068989-2069011 GTTCTGAGGAGAGGGGCTGCGGG 0: 1
1: 0
2: 4
3: 39
4: 383
968703764_968703769 -10 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703769 4:2068980-2069002 GGCGAGCGAGTTCTGAGGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 111
968703764_968703778 7 Left 968703764 4:2068967-2068989 CCCCCAGGGTGGGGGCGAGCGAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 968703778 4:2068997-2069019 GAGAGGGGCTGCGGGGGCCGGGG 0: 1
1: 1
2: 9
3: 98
4: 930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968703764 Original CRISPR CTCGCTCGCCCCCACCCTGG GGG (reversed) Exonic
900142890 1:1145890-1145912 CCCTCTCGGCCCCATCCTGGTGG + Intergenic
900205808 1:1431462-1431484 CAGGCCCGCCCCCACCCTGAGGG + Intergenic
901641031 1:10693190-10693212 CTCTTTAGCCCCCACCCTAGGGG - Intronic
902218086 1:14947269-14947291 CTCCCTCTTCCCCACCCTTGAGG - Intronic
903577871 1:24350342-24350364 CTCCCTCCACCCCACCCAGGAGG - Intronic
904295932 1:29519714-29519736 CTCGCCCTGCCCCACCATGGAGG - Intergenic
904417342 1:30371447-30371469 CTTGCTCACTCCCACCATGGTGG + Intergenic
904674871 1:32192771-32192793 CTCACTGGGCCCCATCCTGGGGG + Intronic
904837758 1:33349931-33349953 CTCCCTCGCCCCGCCCCCGGCGG - Intronic
905238740 1:36568303-36568325 CTGGCTCCCCAGCACCCTGGAGG - Intergenic
915469918 1:156119730-156119752 CCCCCTCCCTCCCACCCTGGTGG + Intronic
915593036 1:156881403-156881425 CTCTCTTGCCCCCAGCCTAGTGG + Intronic
916039767 1:160951962-160951984 CTCACTCACCCCCACCCCGTAGG + Intronic
918215943 1:182391938-182391960 TTCGCTTGCCCCCACCCCAGCGG - Exonic
919464342 1:197912065-197912087 CTCTCTCTCCCCCACCCCGTTGG - Intronic
919670460 1:200333010-200333032 CTCTCTCTCCCCCTCCCTGGAGG - Intergenic
919810138 1:201404145-201404167 CTCTCTCGTCCCCTCCCTCGAGG + Intronic
919812615 1:201418681-201418703 CTCCCACTGCCCCACCCTGGAGG - Intronic
920886972 1:209938476-209938498 CTCGCTCGCCCCGGCCTTCGTGG + Intronic
922728846 1:227939705-227939727 CTCCCTCTGCCCCAGCCTGGGGG - Intronic
924635709 1:245785625-245785647 CTCGCTCGCTCTCTCTCTGGGGG - Intronic
1067662857 10:48249547-48249569 CTCCCTCTTCCCCACCCTGGAGG - Intronic
1068950156 10:62768811-62768833 TCCCCTCGCCCCCACTCTGGTGG - Intergenic
1070284136 10:75071363-75071385 GCTGCTCACCCCCACCCTGGTGG + Intergenic
1072744932 10:97933299-97933321 TTGCCTCACCCCCACCCTGGAGG + Intronic
1072913474 10:99523001-99523023 CTCGCTCGCCTCCTCCTGGGCGG - Intergenic
1076080852 10:127579103-127579125 CTCACTCACCTCCAGCCTGGGGG + Intergenic
1076379894 10:130017705-130017727 CACCTTCGGCCCCACCCTGGGGG + Intergenic
1076736578 10:132461789-132461811 CTCCCTGGACCCCACCCTGCTGG - Intergenic
1077214826 11:1390862-1390884 CTCTCCCGCCCCCACCGCGGAGG - Intronic
1079356069 11:19731157-19731179 CTCCCTATCCCCCACCTTGGTGG - Intronic
1080795337 11:35557907-35557929 CTCCCTCTTCCCCATCCTGGGGG + Intergenic
1083296672 11:61718852-61718874 CGCCCTCTCGCCCACCCTGGGGG + Intronic
1084558484 11:69889417-69889439 CTCCCTGGCCCCCAGCCTGCAGG + Intergenic
1085024023 11:73226174-73226196 CTCCCTCTTCCCCACCCTGCTGG - Intronic
1085521962 11:77144337-77144359 GTCCCTGGTCCCCACCCTGGGGG - Intronic
1087890826 11:103536474-103536496 CTCTCTGGCTCCCACCCTGCTGG - Intergenic
1089320426 11:117622773-117622795 CTCGTTCTCCCCCACCCTCAAGG + Intronic
1092265497 12:6977570-6977592 CCCCTTCACCCCCACCCTGGAGG + Intronic
1096073737 12:48789412-48789434 CTCTCCCGCCCTCACCCCGGGGG + Intergenic
1096102825 12:48979773-48979795 CTCGCCCGCCCATGCCCTGGGGG - Intronic
1097057482 12:56258481-56258503 CGCCCTCCGCCCCACCCTGGCGG + Intergenic
1097953754 12:65462224-65462246 CTCGTTCGCCCCATCCCTGATGG + Intronic
1102302931 12:111783913-111783935 CTCCCTCGGCCCCTCCATGGTGG + Intronic
1102463738 12:113115785-113115807 GTCTCCCGCCCCCACCCAGGAGG - Exonic
1102712916 12:114943927-114943949 CTCCCTCACCCCCACCTTGATGG - Intergenic
1105012025 12:132762124-132762146 CGCGCCCGGCCCCGCCCTGGTGG - Intergenic
1106516961 13:30464721-30464743 CTCGCTCGCGCTCGCCCTCGCGG - Intronic
1107546189 13:41435667-41435689 CTCTCTCTCGCCCACCCCGGGGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1118749188 14:68794262-68794284 CTCTCTCGCCCCCACCGGAGTGG + Intronic
1118917394 14:70119185-70119207 CTCTTTTCCCCCCACCCTGGTGG + Intronic
1119436324 14:74600061-74600083 CTGGCTCTCCCCCACCCCTGTGG - Intronic
1121006737 14:90495573-90495595 CTCCTTGGCCCCCAGCCTGGTGG - Intergenic
1121601074 14:95203293-95203315 ATTCCTCGCCCACACCCTGGAGG + Exonic
1123478794 15:20612396-20612418 CTCCCTCGCCCACATCCAGGGGG - Intergenic
1124024826 15:25955881-25955903 CTCGCTCACTCACTCCCTGGTGG + Intergenic
1124440912 15:29685697-29685719 CTCGCCCCCTCCCTCCCTGGAGG - Intergenic
1124640460 15:31393198-31393220 CCCGCCAGCCCCCACCCTGCTGG + Intronic
1129388789 15:75210217-75210239 CTCACTCCCTCCCACCTTGGGGG + Intronic
1129803883 15:78438296-78438318 CCCGCTGGCCCCCTCCCCGGAGG + Exonic
1131006116 15:88979880-88979902 CCTGGTCGCCCCCACCCTGGAGG + Intergenic
1132582995 16:693936-693958 CTCGCTCGCCCTCCCGCTTGGGG - Exonic
1132690175 16:1178597-1178619 CTCACTCTCCCACAGCCTGGAGG - Intronic
1133055053 16:3141709-3141731 CTCTTTGGCCCCCACCCTGTGGG + Exonic
1133188083 16:4114896-4114918 CTCGCTGGCTCTCACCCTGCTGG - Exonic
1136011594 16:27367166-27367188 CAGGCTGGCCCCCACCCTGCAGG + Intergenic
1136390580 16:29961940-29961962 TTGGTACGCCCCCACCCTGGCGG + Intronic
1138596724 16:58033060-58033082 CTCCCACTCCCCCACCGTGGCGG + Intronic
1139359216 16:66387128-66387150 CTCCCTCATCCCCAGCCTGGGGG + Intronic
1141462704 16:84187115-84187137 CTGGCGCGCCCCCTCCCGGGAGG + Intergenic
1142809694 17:2389678-2389700 CTCACTCCCCTCCAACCTGGGGG + Intronic
1145783152 17:27577312-27577334 CTCCCTGGCCCCCACCCTCCAGG - Intronic
1145982586 17:29022226-29022248 CTTGCAAGCACCCACCCTGGGGG - Intronic
1146126587 17:30235983-30236005 CTCGCTCGGCCCTGCCCTGCCGG - Intronic
1146621399 17:34401327-34401349 CTGTCTTTCCCCCACCCTGGAGG + Intergenic
1147131978 17:38415095-38415117 CTCGCTCTCCCTCCACCTGGAGG - Intergenic
1147168624 17:38605780-38605802 CTCGCTCGGCCCCAGCCCCGGGG + Exonic
1149422787 17:56527511-56527533 CTGGCTTGCTCCCACCATGGAGG + Intergenic
1149597865 17:57874765-57874787 CCCGCCCGCCCCCTCACTGGAGG + Intronic
1149899093 17:60457299-60457321 CTCCCTCTCCCCCACCCTCCAGG + Intronic
1151245714 17:72792978-72793000 GTCCCTCGCCCCCACCCCGCCGG - Intronic
1151618604 17:75231265-75231287 CTTGCTCACCCCCACTCTTGTGG + Intronic
1151815687 17:76470366-76470388 CCCACTCTCCCCCACCCTAGGGG - Intergenic
1152144785 17:78561657-78561679 CTCGCTCTCCCGCACCATGGAGG + Intronic
1152583832 17:81180453-81180475 CCCGCTCACCACCACCCTGCTGG + Intergenic
1153480624 18:5543480-5543502 CGCGCTCGCCCCCAGCCCGAGGG + Intronic
1155002909 18:21704316-21704338 CCCGTTCGCCCGCCCCCTGGGGG - Intronic
1157834113 18:50883365-50883387 CTCCCTGGCCCCCTACCTGGAGG - Intronic
1159004903 18:63003018-63003040 CACGCTCTCCCCCAGCTTGGGGG + Intergenic
1159420194 18:68208536-68208558 CTCACTCACCCCCACCCAGGAGG + Intergenic
1160412202 18:78682887-78682909 CGCGCCCGCCCACTCCCTGGAGG + Intergenic
1160767049 19:813307-813329 CTCGCTCTACCCCACCGTGCAGG - Exonic
1160980019 19:1812408-1812430 TCCGCTCGGCCCCACCCTCGAGG - Intergenic
1161096774 19:2396639-2396661 CACGCTGACGCCCACCCTGGAGG + Exonic
1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG + Intergenic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
1161791318 19:6361862-6361884 CGCGCTCGCCGCGACCCTGGGGG - Exonic
1162502190 19:11060273-11060295 CTCCCACGCCCCCACGCTGCAGG + Intronic
1163248405 19:16111491-16111513 CTCGCGCGCCGGCAGCCTGGCGG - Intergenic
1163698961 19:18777656-18777678 CTCCCTCGCCCCCAGCCCCGGGG + Exonic
1163862058 19:19747819-19747841 CTGGCTCACCCCCACCCAGCAGG + Intergenic
1164179731 19:22807741-22807763 CTGGGTCGCGCCCACCCTGCAGG - Intergenic
1164732562 19:30517384-30517406 CTGGCTGGCCCCCACCCTGCAGG - Intronic
1164834882 19:31350200-31350222 CGCGCCCGCCTCCTCCCTGGAGG - Intergenic
1166930942 19:46301010-46301032 CCCTCTCGCCCCCACCCTCTGGG + Intronic
1167234204 19:48303839-48303861 TTCGCTCCCCCTCACCCAGGAGG - Intronic
1167516946 19:49929104-49929126 CTCGCGCGGCCCCAACCGGGAGG - Exonic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
926185924 2:10690521-10690543 CTGCCTCGCCCCCGCCCGGGAGG - Intergenic
927180972 2:20446753-20446775 ACCGCTCGCCCAGACCCTGGAGG + Intergenic
928190522 2:29161652-29161674 CTCGCTCGCTCTCACCCTGTGGG - Intronic
929670635 2:43874519-43874541 CACACTTACCCCCACCCTGGTGG - Intronic
931257373 2:60585173-60585195 CTTGCTCACCCCCGCCCTGGAGG - Intergenic
931955525 2:67419706-67419728 CTCCCTCACCCCCACCAGGGGGG + Intergenic
941188375 2:162344758-162344780 CCCGCTCGCCCCCAGGCGGGGGG + Intronic
946229562 2:218282993-218283015 CCCCCTTACCCCCACCCTGGAGG + Intronic
946416980 2:219544624-219544646 CTCTCCCACCCCCATCCTGGTGG + Intronic
948490486 2:238309623-238309645 GTCTCTCACGCCCACCCTGGGGG + Intergenic
948763108 2:240204722-240204744 CTCCCTCTCCCCCACCCTCAGGG + Intergenic
949036455 2:241817719-241817741 CTCCCCTGACCCCACCCTGGAGG + Intergenic
1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG + Intronic
1169424346 20:5484741-5484763 CCCTCTCTCCCCCACACTGGGGG + Intergenic
1171849975 20:30301190-30301212 CTCCCTCACCCCCAGCCAGGAGG + Intergenic
1172223627 20:33290050-33290072 CTCCCCCGCCCCCACCATGCAGG + Intronic
1172838240 20:37886654-37886676 ATCCCTCGCCTCCACCCGGGGGG - Intergenic
1173494185 20:43507279-43507301 CGCGCCTGCCCTCACCCTGGAGG - Intergenic
1173867685 20:46323056-46323078 CTGGCTCCCACCCACCCTCGAGG + Intergenic
1175140934 20:56859907-56859929 CTCTCCCGCCCCCACCCCGAGGG - Intergenic
1175219056 20:57406545-57406567 CTCGCCAGCGCCCACGCTGGGGG - Intronic
1175484219 20:59333488-59333510 CTGGCTTGCCCCCACAGTGGGGG + Intergenic
1176060687 20:63171454-63171476 CTCTCATGCCCCCTCCCTGGAGG + Intergenic
1176387524 21:6146196-6146218 CTCGCTCCCCTCCACCCTCTGGG + Intergenic
1179735948 21:43392052-43392074 CTCGCTCCCCTCCACCCTCTGGG - Intergenic
1179748403 21:43455246-43455268 CTGGCCCCCCCCCACCCTGTGGG + Intergenic
1179797403 21:43793414-43793436 CCCGCCCGCCGGCACCCTGGTGG - Intronic
1180631880 22:17235465-17235487 CACGCTGGCGCCCACCCAGGAGG - Intergenic
1181066411 22:20308232-20308254 CTCGGTCCTCCCCACCCTGCAGG + Intergenic
1182321932 22:29483244-29483266 CTCGCTCTCGCCCAGGCTGGAGG - Intronic
1184796928 22:46738167-46738189 TCCGCGCGCCCCCAGCCTGGCGG - Exonic
1184854358 22:47138345-47138367 CTCGCTCCTCCCCAGCCTGCAGG - Intronic
1185244289 22:49765114-49765136 CTGGCAGGCCCCCACCCAGGTGG + Intergenic
950282538 3:11719945-11719967 CTCGCACGCCCCCGCCCCCGAGG + Intronic
950668084 3:14509298-14509320 CTCGGTCTCACCCACACTGGGGG + Intronic
953326139 3:42013797-42013819 CGCGCGCGGCCCCACTCTGGGGG - Intronic
954754996 3:52834309-52834331 CTGGGTGTCCCCCACCCTGGAGG - Intronic
957043118 3:75352205-75352227 CTCTCTCTCGCCCACCCTGGGGG + Intergenic
968703764 4:2068967-2068989 CTCGCTCGCCCCCACCCTGGGGG - Exonic
969365745 4:6693373-6693395 CTCGCTCGCTCCTCCCCTGTGGG - Exonic
980267844 4:130543075-130543097 CTCGCCGGCTCCCACCCTGTGGG - Intergenic
982502024 4:156169411-156169433 CTGGCTTGCCAGCACCCTGGAGG + Intergenic
991499268 5:67259909-67259931 CTCCATTGCCACCACCCTGGTGG - Intergenic
994083324 5:95731546-95731568 CTCGCGCGCCTCCACCGCGGCGG - Exonic
995511743 5:112917622-112917644 CTCACTAGCGCCCACCCTGGAGG + Intronic
996029894 5:118693199-118693221 CTCTATCCCCACCACCCTGGGGG - Intergenic
996210082 5:120798121-120798143 CTCTCTCCCAGCCACCCTGGTGG - Intergenic
997955361 5:138274628-138274650 CTCCCCCGCCCCCACCCCCGCGG - Exonic
998018708 5:138752986-138753008 CGCGCGGGCCCCCACCCCGGCGG - Intronic
1001546294 5:172572613-172572635 CTCGCTCCCTCCCACCCAGCTGG - Intergenic
1002173205 5:177386577-177386599 CAAGCTCTTCCCCACCCTGGTGG - Intronic
1006341995 6:33452244-33452266 GACCCTCACCCCCACCCTGGGGG + Exonic
1007396914 6:41583206-41583228 CTCGCTCACCCCATCACTGGCGG - Intronic
1007588798 6:43008963-43008985 TGCTCTCTCCCCCACCCTGGTGG - Intronic
1007784827 6:44273570-44273592 CTCCCTCCCCACCTCCCTGGGGG + Intronic
1014586331 6:123202230-123202252 CCCCCCCGCCCCCACCGTGGTGG + Intergenic
1019397642 7:830756-830778 CACTCCCGCTCCCACCCTGGGGG - Intronic
1019486920 7:1293633-1293655 CTCCCTGGCCCGGACCCTGGGGG + Intergenic
1019703821 7:2488084-2488106 CTCCCCCGCCCCCAGCCAGGAGG + Intergenic
1021315573 7:19144343-19144365 CTCGCACCCCCGCACCCTTGCGG + Intergenic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1029441086 7:100586900-100586922 CCCGCCCGCCCCCAGCCCGGGGG - Intronic
1034939998 7:155224567-155224589 CTCTCTCCGCCCGACCCTGGAGG + Intergenic
1035169273 7:157008963-157008985 CTCCCTCGGCCCCACCTTGGAGG + Intronic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1038039197 8:23709835-23709857 CGCGCTCGCCCCACCCCTGCAGG + Intergenic
1038404098 8:27309138-27309160 CTGGCTTGGCCCCAGCCTGGGGG + Intronic
1040465812 8:47693930-47693952 CTCCCACACTCCCACCCTGGAGG - Intronic
1044544280 8:93442281-93442303 CTCGCTCTCACCCAGGCTGGAGG - Intergenic
1044549461 8:93495924-93495946 CGCGCTCGCCCCCGCTCTGCCGG + Intergenic
1045547297 8:103140593-103140615 CTCGCCCGCCCCCTCCCTCAGGG - Intronic
1048089036 8:131218658-131218680 CTCTCTCACCCCCAACCTGTAGG - Intergenic
1048450122 8:134525722-134525744 CTTCCTGGCCCCAACCCTGGTGG + Intronic
1048981307 8:139704366-139704388 CGCCCCCGCCCCCTCCCTGGCGG - Intergenic
1049179294 8:141212872-141212894 CGGGCTCCCCCTCACCCTGGTGG + Intronic
1049263316 8:141651691-141651713 CTCGCTCCTCCCGCCCCTGGGGG + Intergenic
1049564796 8:143332399-143332421 CTCACTCTCCCCCATCCTGATGG - Intronic
1053787750 9:41664483-41664505 CTCCCTCACCCCCAGCCAGGAGG + Intergenic
1054157376 9:61650284-61650306 CTCCCTCACCCCCAGCCAGGAGG - Intergenic
1054176026 9:61875825-61875847 CTCCCTCACCCCCAGCCAGGAGG + Intergenic
1054477150 9:65581289-65581311 CTCCCTCACCCCCAGCCAGGAGG - Intergenic
1054661513 9:67704983-67705005 CTCCCTCACCCCCAGCCAGGAGG - Intergenic
1057182606 9:93038050-93038072 CTCCCTTCCCCCCACCCAGGGGG - Intergenic
1061310013 9:129755993-129756015 CTCTCTCGCCCCCAGCCCGTGGG + Intergenic
1061540911 9:131277511-131277533 CGCGCACGCCCCCACTCGGGCGG + Intergenic
1062250769 9:135592512-135592534 CTCACTCACCCCCACCCTGGAGG - Intergenic
1062326470 9:136014865-136014887 CTCGCTCACCCAGACCCTGGTGG - Intronic
1062381796 9:136290375-136290397 CTCGCCCGGCCACTCCCTGGAGG + Intronic
1062396781 9:136355815-136355837 CACGGCCGCCCCCACCCTGGAGG + Exonic
1062713182 9:137987822-137987844 CCCACTCACCCCCACCCTGCTGG + Intronic
1185620926 X:1451764-1451786 CTCCCTATCCCCAACCCTGGAGG + Intronic
1186480447 X:9892804-9892826 CTCACTCTCCCCCAACCTAGTGG + Intronic
1189391007 X:40576838-40576860 CTTTCTCCCCTCCACCCTGGAGG + Intergenic
1189736172 X:44072098-44072120 CTCCCCTGGCCCCACCCTGGGGG - Intergenic
1192033798 X:67543673-67543695 CTCCCTCGCCTCCACCCTGTTGG + Intergenic
1192234934 X:69289728-69289750 CTGCCTCTCCCCCAGCCTGGGGG - Intergenic
1192264593 X:69530006-69530028 CCCCCTCCCCCCCAACCTGGGGG - Exonic
1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG + Exonic
1192557948 X:72105332-72105354 CTGGCTCCCTCCCACCCTGCAGG + Intergenic
1195214374 X:102683885-102683907 CTCACTCACCCCCTCCCTGAGGG + Intergenic
1195347364 X:103963372-103963394 CAAGCCCGGCCCCACCCTGGTGG - Exonic
1195360078 X:104075469-104075491 CAAGCCCGGCCCCACCCTGGTGG + Intergenic
1200068811 X:153517903-153517925 CGCGCCCGCGCCCACCCCGGCGG - Intronic