ID: 968704676

View in Genome Browser
Species Human (GRCh38)
Location 4:2072358-2072380
Sequence CTGTCCCCCTGCTTGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968704676_968704682 -6 Left 968704676 4:2072358-2072380 CCAGACCCCAAGCAGGGGGACAG 0: 1
1: 0
2: 3
3: 25
4: 275
Right 968704682 4:2072375-2072397 GGACAGGGCCTACAGCACACAGG 0: 1
1: 0
2: 1
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968704676 Original CRISPR CTGTCCCCCTGCTTGGGGTC TGG (reversed) Intronic
900188297 1:1343030-1343052 CTGTCCCCATGCTGGGGGGGTGG - Intronic
900188321 1:1343118-1343140 CTGTCCTCCTACCTGGGGGCTGG - Intronic
900322449 1:2091826-2091848 CTGTCCTCCCGCCTGGGGTCAGG - Intronic
900421612 1:2558244-2558266 GTGTCTCCCTGCTTGGGCTCTGG + Intronic
901055187 1:6445957-6445979 CAGTCCCCCTGCTGGGAGGCAGG - Intronic
901237625 1:7676006-7676028 ATGTGTCCCAGCTTGGGGTCGGG - Intronic
901705599 1:11070841-11070863 CGATGCCCCTGCTTGTGGTCAGG - Intronic
901921415 1:12540302-12540324 CTGACCCCCTGCCAGGGGACCGG + Intergenic
902053750 1:13583846-13583868 CTGTCCGGCTGCCTAGGGTCTGG + Exonic
902707684 1:18217015-18217037 CCCTCCCCCTGCTGTGGGTCTGG - Intronic
903859053 1:26354273-26354295 CTGTCACCCTGCTGGGGCACAGG - Intergenic
904044451 1:27601712-27601734 CTGTCCCCCAACCTGGGGTGGGG - Intronic
904498415 1:30900651-30900673 CTGTCCCCCTCCCTGGGCTGGGG - Intronic
904561099 1:31397770-31397792 CTTTCTCCCTGACTGGGGTCAGG + Intergenic
904884514 1:33726262-33726284 CACTCCCCCTCCTTGGGGGCTGG + Intronic
905150239 1:35921427-35921449 CTGCCCCACTGCTTGGGATGGGG + Exonic
905684758 1:39900863-39900885 CTCTGCCCCTGCCTGAGGTCAGG - Intronic
905719651 1:40186119-40186141 CTGTCACCCAGGTTGGGGTGCGG - Intronic
910237096 1:85047951-85047973 CTGTCCCCCTGTTAGAGGTGGGG - Intronic
911761190 1:101619213-101619235 CTGTCCACAAGCCTGGGGTCTGG + Intergenic
912643410 1:111369006-111369028 CTGTCCCTCTGGGTGGGGTAGGG - Intergenic
914224327 1:145707720-145707742 CAGTCCCCCATCCTGGGGTCAGG + Intronic
914407342 1:147389376-147389398 CTTTTCCCTTGCTTGAGGTCAGG - Intergenic
915258928 1:154661073-154661095 CTGTCCCCCTGAGTGTGGGCTGG + Intergenic
915899195 1:159834275-159834297 CTGTCCCCATGCTTAGAGGCTGG - Intronic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
920891716 1:209993423-209993445 ATGTCCCGCAGCTTGGGGTCAGG - Intronic
922471914 1:225882168-225882190 GTCACCCCCTGCTTGGGGTCGGG + Intronic
923071973 1:230573946-230573968 CTGTTCCTCTGCTTGGGCCCAGG + Intergenic
924256642 1:242189835-242189857 TTGCCCCCCTTCTTGGGGCCTGG - Intronic
1064096393 10:12427458-12427480 TTGTCCTCCAGCTTGGGGGCCGG - Intronic
1064357427 10:14632266-14632288 CTGTCCCCCAGGCTGGAGTCTGG - Intronic
1064394015 10:14966098-14966120 CTGTCACCCAGCTTGGAGTGCGG + Intronic
1065522900 10:26589136-26589158 CAGTCCTCCTGCTTGGGGCCTGG - Intergenic
1065527556 10:26638292-26638314 AAGTCCTCCTGCTTGGGGCCGGG - Intergenic
1065527921 10:26641155-26641177 CAGTCCTCCTGCTTGAGGCCTGG - Intergenic
1065528259 10:26643722-26643744 AAGTCCTCCTGCTTGGGGCCTGG - Intergenic
1065528824 10:26648407-26648429 CAGTCCTCCTGCTTGGGGCCTGG - Intergenic
1065558080 10:26936591-26936613 CAGTCCTCCTGGTTGGGGCCTGG + Intergenic
1065558978 10:26943820-26943842 AAGTCCTCCTGCTTGGGGCCTGG + Intergenic
1065559281 10:26946096-26946118 AAGTCCTCCTGCTTGGGGCCGGG + Intergenic
1067672211 10:48333703-48333725 CAGTCCTCCTGTTTGGGGCCTGG + Intronic
1069991203 10:72317298-72317320 CTGTCCCTCTGCCTGGCCTCAGG + Intergenic
1070325231 10:75384611-75384633 CTGTGTCCCTGCTAGGGGCCTGG - Intergenic
1071498080 10:86182273-86182295 GTCGCCCCCTGCTTGGGGCCGGG - Intronic
1071816686 10:89239529-89239551 CTGTCACCCTGCTGGGGAGCAGG + Intronic
1073102054 10:101011654-101011676 CTGTGCCCCTCCCTGGGCTCTGG + Intronic
1073176721 10:101561420-101561442 CTCTCCCCCAGCTTTGGGGCTGG + Intergenic
1073375716 10:103032412-103032434 CTGTCCCCCAGGTTGGAGTGCGG - Intronic
1074599757 10:114901632-114901654 CTGTCCCCATGCCTTGGTTCAGG + Intergenic
1075589071 10:123678468-123678490 GTGTCTTCCTCCTTGGGGTCAGG + Intronic
1076290280 10:129340561-129340583 TGGTCCCACTGCTGGGGGTCGGG - Intergenic
1077176830 11:1194940-1194962 CTGTCCCCCAGCTGGGGGTGGGG + Intronic
1077460228 11:2705440-2705462 CTGAGCACCTGCTTGGGGCCTGG + Intronic
1077696006 11:4393446-4393468 CTGGCCCCCTGCTTGGGAGGAGG - Intronic
1078709447 11:13776712-13776734 CTGTCTCCCTGCCTGGGGCCTGG + Intergenic
1081472641 11:43390284-43390306 CTGTCACCCAGCCTGGAGTCTGG - Intronic
1082001060 11:47394030-47394052 CTGCCAGCCTGCCTGGGGTCAGG - Intergenic
1083839305 11:65294667-65294689 CAGTCATCCTGCTTGGGGCCTGG - Intronic
1084484008 11:69437667-69437689 GTGTCCCCCTGCTAGGGGAGGGG + Intergenic
1084915350 11:72424847-72424869 CTGTCCCCCAGGTTGGAGTGCGG - Intronic
1085322270 11:75582563-75582585 CAGCCCCCCGGCTTGGGCTCAGG + Intergenic
1085396409 11:76209145-76209167 CCGGCCCCTTGCTTGGGGCCGGG + Intronic
1085440800 11:76560814-76560836 CTGGCCCTGTGCTTGGGGTCTGG - Intergenic
1085823375 11:79817165-79817187 CTTTCCCCCTGCATAGTGTCAGG + Intergenic
1087059363 11:93962926-93962948 CAGTTCCCCTGCTCAGGGTCTGG + Intergenic
1089052620 11:115558774-115558796 CTCACCTCCTGCTTGGGGTTGGG - Intergenic
1089757084 11:120695125-120695147 CTCTCCTCCTGCTGGAGGTCAGG + Intronic
1094492570 12:30970214-30970236 GTGTCTCCCTGTTGGGGGTCTGG + Intronic
1096092373 12:48911518-48911540 CTGTCACCCAGGCTGGGGTCAGG - Intronic
1097923389 12:65101891-65101913 ATATCCCCCAGCTTGGGATCAGG + Intronic
1100809665 12:98325477-98325499 CTGCCCCTCTGCATGGGGCCAGG + Intergenic
1101706620 12:107226385-107226407 CTATCCCCCTGGTGGGGGTGGGG - Intergenic
1101967882 12:109293331-109293353 GGGTCCCTGTGCTTGGGGTCTGG - Intronic
1102310190 12:111838650-111838672 CTCTCGCCCTGCATGTGGTCTGG - Intergenic
1103579548 12:121904113-121904135 CTATGCCCCTGCTAGTGGTCAGG + Intronic
1104039161 12:125118261-125118283 CTGTCATACTGCTGGGGGTCAGG + Intronic
1104272523 12:127294834-127294856 CTGTGTCCCTGCTTGGCTTCAGG + Intergenic
1104294243 12:127497205-127497227 CTGCTCACCTGCTTGGTGTCTGG - Intergenic
1104942337 12:132400883-132400905 CTCTCTCCCTGCTGGGGGCCGGG + Intergenic
1104947349 12:132422032-132422054 CTGTCCTCCTGCTATGGGGCTGG - Intergenic
1106054939 13:26229113-26229135 CTGTCCCCCTGCTTTGAGGGGGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1109143014 13:58739964-58739986 GTGTCAGCCTGCTTGGGTTCTGG + Intergenic
1110305075 13:73977085-73977107 CTGTCACCCAGATTGGAGTCCGG + Intronic
1114449407 14:22815101-22815123 CTGTCTCCCTGCCTTGGCTCGGG - Intronic
1116682766 14:47995738-47995760 CTGTCACCTTGCTGGGGCTCAGG + Intergenic
1118046149 14:61973895-61973917 CTGTCCTCCTTCTCAGGGTCTGG - Intergenic
1119391720 14:74295469-74295491 TTGTCCCCCTCCTTTGGGCCAGG - Intronic
1121245666 14:92459433-92459455 CTCTGCCCTTGCTTGGGGGCAGG + Intronic
1121593397 14:95137659-95137681 TTTTCACCTTGCTTGGGGTCTGG - Intronic
1121711165 14:96039842-96039864 CTGTCCCCCTTCTGGGGTCCCGG + Intronic
1122353307 14:101109866-101109888 CTGATTCCCTGCTTGGGGCCAGG + Intergenic
1122505116 14:102227244-102227266 CTGTCCCCCGGCCTGGCTTCAGG - Intronic
1122773627 14:104107806-104107828 CTGTGCCCCTGCGTGGGGGGCGG + Intronic
1123112975 14:105881684-105881706 CTGTCCCTCTGTCTGGTGTCTGG + Intergenic
1123189863 14:106558895-106558917 CTGTCCCCTTTCTTGGGGAAAGG - Intergenic
1123440299 15:20286057-20286079 CTGTACTCCTGCTAGGGGTTGGG + Intergenic
1124278314 15:28344130-28344152 CTGTGCCCCTTTTTGGGGTGAGG + Intergenic
1124304388 15:28567478-28567500 CTGTGCCCCTTTTTGGGGTGAGG - Intergenic
1124340582 15:28886961-28886983 ATGGCGCCCTGCTTGGGGACCGG - Intronic
1124346816 15:28928581-28928603 CTGGCCTCCTGTTTGGGGTCTGG - Intronic
1124363773 15:29057036-29057058 CTGTGCACCTGCTTGAGGCCAGG - Intronic
1124533263 15:30523945-30523967 CTGTGCCCCTTTTTGGGGTGAGG - Intergenic
1124765394 15:32483699-32483721 CTGTGCCCCTTTTTGGGGTGAGG + Intergenic
1125577882 15:40767561-40767583 CTGCCCTCCTGCTTCGGGCCTGG + Exonic
1128248684 15:66150173-66150195 CTGGCTCCCTGCTCGGGGGCTGG - Intronic
1128601775 15:69001065-69001087 ATATCTACCTGCTTGGGGTCTGG + Intronic
1129200906 15:73998649-73998671 CTATCCACCTGCGTGGGGACTGG - Intronic
1129266944 15:74398206-74398228 TTGAGCCCCTGCTTGGTGTCAGG - Intergenic
1132215286 15:100057696-100057718 AAGTCCCCCTGTTTGGGGTTGGG - Intronic
1132689108 16:1174593-1174615 CTCTGCCCCTGCTTGGGGAGGGG - Intronic
1133022827 16:2974351-2974373 GTGGCCCGCAGCTTGGGGTCTGG + Exonic
1134090391 16:11388504-11388526 CTGCCTCCCTGCTTGGAGCCCGG + Intronic
1135495590 16:22948571-22948593 CTGCACCCCTGCTTTGGGCCAGG + Intergenic
1137057939 16:35754274-35754296 CTGTGCCCCTGCTGGGGCCCAGG + Intergenic
1138008262 16:53356847-53356869 CTGTGCCCCTTTTTGGGGTTAGG + Intergenic
1138230418 16:55332032-55332054 CTGACCCGCGGCTTAGGGTCCGG + Intergenic
1138346353 16:56322592-56322614 CCTTCCCTCTGCTTGGGGGCTGG + Intronic
1138504900 16:57473405-57473427 CTGTCCCCCTGGCTGGGCTTTGG + Exonic
1139203626 16:65004642-65004664 CTGACCCCGTGCTTGTGGGCAGG - Exonic
1139404289 16:66706181-66706203 CTGTCCCTCTCCTTGGTGGCAGG + Intergenic
1139636022 16:68259045-68259067 CTGGGCCCCTGGCTGGGGTCTGG + Intronic
1141137987 16:81478949-81478971 CTCTCACCCTGCTTCGGGTGAGG - Intronic
1141673516 16:85505408-85505430 CTGTCACTCTGCCTGGGGGCTGG + Intergenic
1141703371 16:85652378-85652400 CTGACGCCCTGCGTGGGGCCGGG - Intronic
1142302454 16:89266568-89266590 CTGGGCCCCTGCGTGGGGTTGGG - Intergenic
1142496553 17:309418-309440 CCAGCCCCCTGCTGGGGGTCCGG + Intronic
1142496572 17:309473-309495 CAGCCCCCCTGCTGGGGGTCCGG + Intronic
1142496597 17:309533-309555 CAGCCCCCCTGCTGGGGGTCCGG + Intronic
1142496639 17:309646-309668 CCAGCCCCCTGCTGGGGGTCTGG + Intronic
1142496680 17:309765-309787 CAGCCCCCCTGCCAGGGGTCCGG + Intronic
1143118256 17:4592560-4592582 CTCTCTCCCTGCTGGGGTTCAGG - Intronic
1143709043 17:8721126-8721148 CTGTCCCGCTGTTTGATGTCAGG - Intergenic
1143933620 17:10458566-10458588 CTTTCCCACTGCTTAGGGTAGGG + Intronic
1143972740 17:10807192-10807214 TTCTCACCCTGCTTGGGTTCTGG + Intergenic
1144144729 17:12386456-12386478 CTGACCTCCTGCTGGGTGTCAGG + Intergenic
1145007293 17:19344847-19344869 CTGGCTCCCTCCTTGGGGTTGGG - Intronic
1145845346 17:28033824-28033846 CTGTCTCCATGCTTCGGGCCTGG - Intergenic
1145913237 17:28554682-28554704 CTGCACTCCTGCTTGGGGGCTGG + Intronic
1146578180 17:34012981-34013003 CAGCCCCCCTGCTTTGAGTCAGG + Intronic
1146928264 17:36760006-36760028 CTGTCCCCTTTCTTGGGGATAGG + Intergenic
1146997557 17:37334353-37334375 CTTTCCCTCTTCTTGGGGACAGG - Intronic
1150655571 17:67037082-67037104 CTTTCCCCCTTCTTGTGGTCTGG + Intergenic
1151158148 17:72141938-72141960 CTGTCCCCCTGGCTGGAGTGTGG + Intergenic
1151694119 17:75705437-75705459 CAGCCCCTCTGCTTGGGGTGAGG - Intronic
1151757720 17:76084063-76084085 CTGTCCCTCTGCTCTGTGTCTGG + Exonic
1151946080 17:77320671-77320693 CTGCCCCCCTGGCTCGGGTCTGG + Intronic
1152209696 17:78996504-78996526 CCCTCCCCCTGCTGGGGTTCAGG + Intronic
1152760105 17:82103310-82103332 CTGGCCCCCTGCTGGGGTCCTGG + Intronic
1152863857 17:82710738-82710760 CTGTCGGCCTGTGTGGGGTCTGG - Intergenic
1157349219 18:46870020-46870042 CTGTGCACCTGCTTGGGGTGGGG - Intronic
1157579333 18:48764404-48764426 CTGCCCCCCATCTTGGGCTCTGG + Intronic
1158028176 18:52928898-52928920 TTGTCCCACTGCTTGGTGGCTGG + Intronic
1159741493 18:72176753-72176775 TTCTCCCCGTGCTTTGGGTCAGG - Intergenic
1160811284 19:1013980-1014002 CTGTCGCCCTGCTAGAGGCCTGG - Intronic
1161298665 19:3532406-3532428 CTGTCCCCCAGCTGCTGGTCTGG + Exonic
1161504266 19:4635698-4635720 CTGTCACCCTCCCTGGGGTCGGG - Intergenic
1162340986 19:10091498-10091520 CCGTCCCCCTGCTACGGGTGCGG + Exonic
1163420521 19:17211512-17211534 CAATCCTCCTGCTTGGGGTGGGG + Intronic
1164573918 19:29394271-29394293 CTGGCCCTCTCCCTGGGGTCTGG + Intergenic
1164681739 19:30138853-30138875 CTGCCCCTCTGATTGGAGTCTGG + Intergenic
1165378200 19:35458983-35459005 CTGTCATCCTGCTTTGGGGCAGG - Intergenic
1165726158 19:38114533-38114555 CCATCCCCCTGCCTGGGGTAAGG + Intronic
1165924378 19:39318247-39318269 CTGTCAGCCAGCTGGGGGTCTGG - Intergenic
1167269280 19:48498691-48498713 CTGTCCCCCGGCTTGGGGCCCGG + Exonic
1167272470 19:48513693-48513715 CTGGGCCCCTGCTGGGGGTTGGG - Intergenic
1167311617 19:48740514-48740536 CTCTTACCCTGCTTCGGGTCCGG + Exonic
1167338022 19:48898479-48898501 CTGCCCACCTGCCTGGGATCCGG + Intronic
931565707 2:63613794-63613816 CTCTCCCTGTGCTTGGGGTTTGG - Intronic
934319346 2:91958241-91958263 CTGTGCTCCTGCTAGGGGTTGGG + Intergenic
934854075 2:97718251-97718273 TTGATCCCCTGCCTGGGGTCTGG + Intronic
937628401 2:124069386-124069408 CTCTGGCCCTGCTTAGGGTCTGG + Intronic
942044242 2:172090225-172090247 CCGGGCCCCTGCTTGGCGTCTGG - Intergenic
947924774 2:233911686-233911708 CTGTCCCCCTGTCTGGGATGTGG + Intergenic
948444564 2:238022204-238022226 CTGTCCCCCAGGCTGGAGTCCGG + Intronic
1169195619 20:3680838-3680860 CTCTCTCCCTCATTGGGGTCAGG - Intronic
1171197012 20:23207525-23207547 CTGTCCCCATGCTGGTGGTGGGG - Intergenic
1171725936 20:28620849-28620871 CAGTCCTCATGCTTGGGGCCTGG - Intergenic
1171857578 20:30361511-30361533 CAGTCCTCATGCTTGGGGCCTGG + Intergenic
1172411829 20:34730102-34730124 CTGTCCCCCAGGCTGGGGTGTGG + Intronic
1173204147 20:40979537-40979559 CTCTGCACCTGCTTGGGGCCTGG - Intergenic
1173364658 20:42373976-42373998 CTGTCACCCTGTTTGGGAACTGG + Intronic
1173538398 20:43833022-43833044 TTGTCCCCCTGCCTGTGCTCTGG + Intergenic
1180102710 21:45596803-45596825 CTGTCACACTGCATGGGCTCCGG + Intergenic
1180125510 21:45787626-45787648 GAGTCCCCCTGCTTGGGCCCTGG + Intronic
1180307529 22:11141885-11141907 CTGTGCTCCTGCTAGGGGTTGGG + Intergenic
1180546049 22:16504108-16504130 CTGTGCTCCTGCTAGGGGTTGGG + Intergenic
1180621406 22:17164953-17164975 AGGTCCCCCTGGCTGGGGTCAGG + Intronic
1180632130 22:17236967-17236989 CTGTCCCCCAGGCTGGGTTCAGG - Intergenic
1180967203 22:19796796-19796818 CTGCTGCCCTGCCTGGGGTCAGG - Intronic
1181304131 22:21904851-21904873 CTGTCCTCCTGATGGGGGTGTGG + Intergenic
1181379139 22:22485870-22485892 TTGTCTCCCTGCTTGTGTTCTGG - Exonic
1181460887 22:23085359-23085381 GTGTGGCCCTGCTTGGGGACAGG - Intronic
1181647174 22:24238190-24238212 CTGTCCCCCAGGCTGGGGTGTGG - Intronic
1182020003 22:27073688-27073710 CTGTCCCCCTGCCTGGAGGCTGG - Intergenic
1182213129 22:28693286-28693308 CTGTGCTCCTGCTAGGGGTTGGG - Intronic
1183780424 22:39995484-39995506 CTGACCACCTGCTTGAGGTGCGG - Exonic
1185280674 22:49968616-49968638 CTGTCCCACTGCTCAGGGCCTGG - Intergenic
1185410003 22:50676868-50676890 CTGGCCCCATGGTTGGGGTCAGG + Intergenic
950263837 3:11560746-11560768 CTGTCCCGCTGCTAAGTGTCGGG - Intronic
950678700 3:14570068-14570090 CTCTCCCTTTGCTTGGGCTCTGG - Intergenic
952248664 3:31627122-31627144 CTGGTCCGCTGCCTGGGGTCTGG - Intronic
953305072 3:41821541-41821563 CTGTCCCTCCACTTGGGCTCAGG + Intronic
953418992 3:42740154-42740176 CTTTTCCCCTGCTTGGGGAGGGG - Intronic
953760284 3:45681545-45681567 CTGGCCCTCTTCTTGGGGCCTGG - Exonic
954627111 3:52028622-52028644 CTGTCCCTCTGCTGGGGGCCTGG + Intergenic
955273645 3:57526868-57526890 CTGTCACCCAGGTTGGGGTGTGG + Intronic
961481775 3:127185008-127185030 CTGTCCCCCTACCTGAGGCCTGG - Intergenic
962482443 3:135809407-135809429 CTGTGCCCCTTCTCTGGGTCTGG + Intergenic
963395304 3:144724969-144724991 CTGTCCTCTTCCTTGGAGTCAGG + Intergenic
968437517 4:601815-601837 GTTTCCCCCTGTTTGGGGACTGG + Intergenic
968452037 4:680405-680427 GTCTCCCCCTGCTTGGGGCAGGG + Intronic
968704676 4:2072358-2072380 CTGTCCCCCTGCTTGGGGTCTGG - Intronic
968935098 4:3605641-3605663 ACGTCCCCCTGCCTGAGGTCTGG + Intergenic
968936409 4:3612669-3612691 CTGTTCCCCTGCCTGGGATCAGG - Intergenic
971021121 4:22536783-22536805 CTGTCCCCCAGGTTGGAGTGCGG + Intergenic
971906470 4:32732547-32732569 CTGAGCCCCTGCGTGGGGTGGGG + Intergenic
972823695 4:42731929-42731951 CTGTACCCCAGCCTGGGGCCTGG + Intergenic
973936742 4:55853893-55853915 CTGTCTCCACGCCTGGGGTCGGG + Exonic
980092355 4:128455778-128455800 CTGTCCCCCAGCCTGGGCTATGG + Intergenic
980619119 4:135274512-135274534 CAGTCCCCTTGCTTTGGTTCAGG + Intergenic
981929379 4:150173356-150173378 CTTTCCCTCTTCTTGTGGTCTGG + Intronic
982281104 4:153684394-153684416 CTGCACCCCTTCCTGGGGTCGGG + Intergenic
983687847 4:170432078-170432100 GTGTGCTCCTGCTGGGGGTCAGG - Intergenic
985434616 4:189916946-189916968 CAGTCCTCATGCTTGGGGCCTGG + Intergenic
988490818 5:31703708-31703730 CAGTTATCCTGCTTGGGGTCTGG - Intronic
988779120 5:34503082-34503104 CTGTCCCCAAGCTTGGAGTGGGG - Intergenic
990217771 5:53552958-53552980 TCCTCCCCCTGCTTGGGGTGGGG + Intergenic
990879889 5:60527487-60527509 CTGCTCCCCTGTTTGGAGTCTGG - Intergenic
992405374 5:76452389-76452411 CTGTCCCCCTTCCTGGGGGGAGG - Intronic
997262484 5:132475446-132475468 CTGCCCTCCTGCTGGGGTTCTGG - Intronic
1000010096 5:157223035-157223057 CTGTCCCCGTGTTTGAGGTGTGG + Intronic
1001969002 5:175938719-175938741 CTGCCTCCCTGCCTGGGGGCGGG - Intronic
1002248441 5:177905026-177905048 CTGCCTCCCTGCCTGGGGGCGGG + Intergenic
1002624206 5:180513405-180513427 CTGTCGCCCAGCCTGGAGTCTGG + Intronic
1002838730 6:887674-887696 CTGTGCACCTGCCTGGCGTCTGG + Intergenic
1003441301 6:6145168-6145190 CAGTCCCCTTTCTCGGGGTCAGG - Exonic
1005294607 6:24413117-24413139 CTTTCCCCCTGCTTGGTAACTGG - Intronic
1005839996 6:29738024-29738046 CTGTCCCCGTGTTTGGGGGAAGG - Intronic
1007290370 6:40781226-40781248 CTGTCCCCCTCCATGGGGGCTGG + Intergenic
1007967789 6:46017976-46017998 CTTTCCTCCTGCTTGGCTTCAGG + Intronic
1013233062 6:108174595-108174617 TTGTCCGCTTTCTTGGGGTCCGG + Intronic
1014497496 6:122143904-122143926 CTGTCCTCCTCCTTGGTGTTGGG - Intergenic
1015924141 6:138292651-138292673 CTGTGCCCGTGCCGGGGGTCTGG - Intronic
1017626415 6:156353419-156353441 CTGTCACCCAGGTTGGGCTCAGG - Intergenic
1018418273 6:163620270-163620292 CTGTACCCCTGGTTGGGCTCTGG - Intergenic
1018982032 6:168608384-168608406 CTGTCTCCCTGCCTGGACTCAGG - Intronic
1019305581 7:332911-332933 GTGTCCCCCAGCTTGGGAGCGGG + Intergenic
1019597455 7:1864737-1864759 CTGGCCCCCTCCCTGGGGTGAGG + Intronic
1020692109 7:11368569-11368591 CTGTCCCCCTGCCTGTTGTGAGG - Intergenic
1022195763 7:28065885-28065907 CCCACCCCCTGCTTGGTGTCAGG - Intronic
1023141349 7:37105410-37105432 CTGTACCCATCCTTGGGGCCAGG - Intronic
1023343907 7:39251800-39251822 CTGTGCCCATGCTGGGGGTCTGG - Intronic
1023834733 7:44061466-44061488 CTGTCCCTCTGCCTGGGCTATGG + Exonic
1023857382 7:44193057-44193079 CTGTCCTCCTCCCTGGGGTGGGG + Intronic
1025729824 7:64099794-64099816 CTGGCCCCTTGGTTAGGGTCGGG + Intronic
1029241820 7:99168545-99168567 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1032387085 7:131532606-131532628 ATGGTCCCCTGCTTGGGCTCAGG + Intronic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1036700747 8:11012209-11012231 CTGTCCCCATGCTGGCTGTCAGG - Intronic
1036900602 8:12666481-12666503 CTGAGCCCCGGCTGGGGGTCTGG - Intergenic
1037910059 8:22739035-22739057 CTGGCCCCCTGCCAGGGGCCTGG - Intronic
1038799429 8:30735800-30735822 CTGTCCCCCAGGCTGGGGTGCGG - Intronic
1039375129 8:37025205-37025227 CTGTCTCTCTGCTAGGGCTCAGG + Intergenic
1041531021 8:58867390-58867412 CTGTCCCCATTCTGGGGGTGGGG + Intronic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1043649943 8:82578782-82578804 CTGCCCCTCTGCTTGGGGTCAGG - Intergenic
1045529370 8:102970040-102970062 CTGTCCATGTGCTTGGGGTGGGG + Intronic
1047676408 8:127207717-127207739 CTTTCTGCCTGCTTGGGGTTTGG + Intergenic
1049225631 8:141449259-141449281 CCCTCCCCATGCTTGGGTTCTGG - Intergenic
1049397506 8:142408121-142408143 CCCTCCAGCTGCTTGGGGTCGGG + Intergenic
1049618179 8:143585555-143585577 CTGACCCCGTTCTTGGGGCCAGG + Intronic
1049741731 8:144244301-144244323 CCGTCCTCCTCCTTGGGCTCAGG - Exonic
1053449188 9:38179210-38179232 CAGCCCCTCTTCTTGGGGTCAGG - Intergenic
1053723675 9:40975019-40975041 CAGTCCTCATGCTTGGGGCCTGG + Intergenic
1054342285 9:63876980-63877002 CAGTCCTCATGCTTGGGGCCTGG - Intergenic
1056177119 9:84045753-84045775 CTGCCCCTCTGCTGGGGGTGGGG + Intergenic
1056771172 9:89479266-89479288 CTGTCCCCTTGCTGTGGATCTGG - Intronic
1057186557 9:93060354-93060376 CTGTCCACAAGCTTGGGGGCAGG - Intronic
1058890327 9:109355652-109355674 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1058938839 9:109794519-109794541 CTGGCTCCCTGCTTGGACTCAGG - Intronic
1061055100 9:128218355-128218377 CTGGCCCTCAGCTTGGGGACGGG - Intronic
1061163918 9:128911589-128911611 CTGTCCTCCTGGTTGGGGGAGGG + Intronic
1061257424 9:129460714-129460736 CTGCCCACCTCCCTGGGGTCTGG + Intergenic
1061536781 9:131255234-131255256 CTTCCCACCTGGTTGGGGTCTGG - Intergenic
1061621617 9:131814480-131814502 CTGCTCCCCTTATTGGGGTCTGG - Intergenic
1061972501 9:134052640-134052662 CTCTGCACATGCTTGGGGTCTGG - Intronic
1062166508 9:135110352-135110374 CTGGCCCCCTTTTTGGTGTCTGG - Intronic
1062170393 9:135131808-135131830 CATTCCCCTGGCTTGGGGTCAGG - Intergenic
1062294315 9:135815950-135815972 CTGTGCTCCTGCTTGGGTTACGG + Exonic
1062302954 9:135885885-135885907 CTGTCACCCAGTTGGGGGTCTGG - Intronic
1062474450 9:136720322-136720344 CTGTCCCCATCCTTGGTGTGTGG + Intronic
1203451484 Un_GL000219v1:120979-121001 CAGTCCTCATGCTTGGGGCCTGG - Intergenic
1185455410 X:307924-307946 CTGTCTGCAAGCTTGGGGTCAGG - Intronic
1185677756 X:1862353-1862375 ATGTATCCCTGCTTGGGGTCAGG - Intergenic
1185886570 X:3788820-3788842 CTCTCCTTCTGCTTGGGGTGAGG - Intergenic
1186363361 X:8866094-8866116 CTGTCCCCCAGGTTGGAGTGTGG + Intergenic
1190305138 X:49077729-49077751 CTGCCCACCTGCTCGTGGTCTGG + Exonic
1197758662 X:130013381-130013403 CTGTCCCCCTGCTCCCGGTTCGG + Exonic
1197798820 X:130328037-130328059 CTGTGCCACTGATTGTGGTCAGG + Intergenic
1200091679 X:153638909-153638931 CTCTTCCCCTGCATGGGGTCTGG + Intergenic
1200839460 Y:7765711-7765733 CTGGCTCCCTGCTTATGGTCAGG + Intergenic
1201186874 Y:11413352-11413374 CTGTGCTCCTGCTAGGGGTTGGG + Intergenic