ID: 968705403

View in Genome Browser
Species Human (GRCh38)
Location 4:2075261-2075283
Sequence TTTCAAGGGTCCCCAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968705388_968705403 27 Left 968705388 4:2075211-2075233 CCTGGCGCTCTCTGAGGGGCTGG 0: 1
1: 0
2: 1
3: 34
4: 284
Right 968705403 4:2075261-2075283 TTTCAAGGGTCCCCAAACCCAGG 0: 1
1: 0
2: 7
3: 77
4: 416
968705396_968705403 1 Left 968705396 4:2075237-2075259 CCCAGGGTGGAGCCCACTTGGGC 0: 1
1: 0
2: 1
3: 32
4: 719
Right 968705403 4:2075261-2075283 TTTCAAGGGTCCCCAAACCCAGG 0: 1
1: 0
2: 7
3: 77
4: 416
968705397_968705403 0 Left 968705397 4:2075238-2075260 CCAGGGTGGAGCCCACTTGGGCC 0: 1
1: 0
2: 1
3: 14
4: 229
Right 968705403 4:2075261-2075283 TTTCAAGGGTCCCCAAACCCAGG 0: 1
1: 0
2: 7
3: 77
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968705403 Original CRISPR TTTCAAGGGTCCCCAAACCC AGG Intronic
903319228 1:22532146-22532168 GTGCAAGGGTCTCCAAAACCAGG + Intergenic
903841692 1:26246917-26246939 TATCAGGGGTCTCCAACCCCTGG + Intronic
904564588 1:31420988-31421010 TAGCAGGGGTCCCCAACCCCTGG + Intronic
906118965 1:43374802-43374824 GCCCAAGGGTCCCCAACCCCTGG - Intergenic
906664680 1:47612057-47612079 CATCAGGGGTCCCCAACCCCCGG + Intergenic
907017597 1:51032339-51032361 TGACAGGGGTCCCCAACCCCTGG - Intergenic
907057467 1:51383698-51383720 TTGCAGGGATCCCCAAACCCTGG - Intronic
907121926 1:52015521-52015543 GATCAAGAGTCCCCAGACCCTGG - Intergenic
907226843 1:52955722-52955744 TTTGAAGGGTTCTCAAAGCCTGG - Intronic
907481099 1:54746062-54746084 TTGCAGGGGTCCCCAACCCCTGG + Intergenic
907788238 1:57635260-57635282 ATCCAGGGGTCCCCAAACCCCGG + Intronic
908110176 1:60888758-60888780 ATGCAGGGGTCCCCAACCCCTGG - Intronic
910222221 1:84899061-84899083 TTTCAGGGGTCCCTAACCCTGGG - Intergenic
910232391 1:84999153-84999175 CTGCAGGGGTCCCCAAACCCCGG - Intronic
910469019 1:87530982-87531004 CTGCAATGGTCCCCAACCCCAGG + Intergenic
911005189 1:93213226-93213248 CTGCAGGGGTCCCCAACCCCTGG - Intronic
911505127 1:98739326-98739348 TTACAGGGGTCCTCAACCCCTGG - Intronic
911538027 1:99123969-99123991 TTTTAAGCATCCCCAAACCAAGG - Intergenic
914310066 1:146458640-146458662 TTGCAGGGGGCCCCAAGCCCCGG + Intergenic
914698578 1:150108930-150108952 CGATAAGGGTCCCCAAACCCAGG - Intronic
914760362 1:150593665-150593687 AGACAGGGGTCCCCAAACCCTGG - Intergenic
916346452 1:163797298-163797320 GAACAGGGGTCCCCAAACCCAGG + Intergenic
917453375 1:175165717-175165739 TTCCAAGGGTCCCAAAGCCTGGG - Intronic
917826677 1:178829292-178829314 GAACAGGGGTCCCCAAACCCCGG + Intronic
917850581 1:179060358-179060380 TGTCAGGGGTCCCCAACCCCTGG + Intronic
918762771 1:188434970-188434992 GCTCAAGGGTCCCCAACCCCTGG - Intergenic
919501433 1:198342123-198342145 AATCAGGGGTCCCCAACCCCTGG - Intergenic
920424760 1:205866180-205866202 TACCAAGGATCCCCAACCCCTGG - Intergenic
921016348 1:211195597-211195619 TGTCAGGGGTCCCCAACTCCTGG + Intergenic
921173162 1:212566770-212566792 TTTCAGGGGTCCCCAGACCCTGG - Intronic
921442726 1:215207136-215207158 AATCAGGGGTCCCCAACCCCTGG + Intronic
922865308 1:228855749-228855771 GATCAGGGGTCCCCAACCCCTGG + Intergenic
924277025 1:242399665-242399687 TATCGGGGGTCCCCAATCCCCGG + Intronic
924831468 1:247600092-247600114 TTTTATGGATCCCCAAACCAGGG - Intergenic
1063554624 10:7066411-7066433 TTGCAGGGGTCCCCAGCCCCAGG - Intergenic
1063956593 10:11273197-11273219 AGCCAAGGGTCCCCAACCCCTGG + Intronic
1064178458 10:13095685-13095707 AAGCAGGGGTCCCCAAACCCCGG - Intronic
1065073166 10:22048908-22048930 TGTCAGGGCTCCCCAACCCCAGG + Intergenic
1065121476 10:22534503-22534525 TAGCAGGGGTCCCCAAACCCCGG - Intergenic
1067225826 10:44375107-44375129 TTGCAAGGGTCCTGAATCCCTGG - Intronic
1068872072 10:61956094-61956116 TAACAGGGGTCCCCAATCCCCGG + Intronic
1069280142 10:66645556-66645578 TTCCAGGGCTCCCCAACCCCTGG + Intronic
1070112510 10:73498795-73498817 GTTCCAGGGTCCCGAACCCCTGG - Exonic
1070483649 10:76909702-76909724 TTTCTGGGATCCCCAAAACCAGG + Intronic
1070691711 10:78531963-78531985 GATCAAGGGTCCCCAACCCCTGG - Intergenic
1072256929 10:93629928-93629950 GATCAGGGGTCCCCAATCCCTGG - Intronic
1072829303 10:98640702-98640724 TTCAAAGGGTCCCCATTCCCTGG + Intronic
1073135709 10:101219004-101219026 TTTCCAGGGTCCCCAGAGCTGGG + Intergenic
1073587815 10:104727654-104727676 TTTTAGGGGTCCCCAACCCCTGG + Intronic
1073607965 10:104915007-104915029 GTTCACCTGTCCCCAAACCCTGG - Intronic
1075304533 10:121355994-121356016 TTTCCTGGGTCACCAAATCCCGG + Intergenic
1077342576 11:2032629-2032651 TTTCCTGGGACCCCAAACTCTGG + Intergenic
1077835974 11:5928768-5928790 TTTCATTGGTGCCAAAACCCGGG + Intronic
1077901546 11:6494031-6494053 GATCAGGGGTCCCCAACCCCCGG + Intronic
1078020613 11:7653407-7653429 TGGCAATGGTCCCCAAAGCCTGG - Exonic
1078949694 11:16116682-16116704 GTGCAAGGGTCTCCAACCCCTGG + Intronic
1079105774 11:17571436-17571458 CTCCAAGAGTCACCAAACCCAGG - Intronic
1081623352 11:44632223-44632245 TCCCCAGGGTCCCCAAGCCCAGG - Intergenic
1083344148 11:61977817-61977839 TATCAGGGGTCCCCAACCCCTGG + Intergenic
1084465423 11:69320446-69320468 TTGCAGGAGTCCCCAAACCAAGG + Intronic
1084994612 11:72963878-72963900 AATCCAGGGTCCCCAACCCCAGG - Intronic
1085193211 11:74647221-74647243 TACCAGGGGTCCCCAACCCCCGG - Intronic
1086404802 11:86490313-86490335 TTTCAAGGGTGTCCAATCCAGGG - Intronic
1086470567 11:87105199-87105221 TCACAGGGGTCCCCAAACCCTGG + Intronic
1086648814 11:89260810-89260832 TAACAGGGGTCCCCAACCCCTGG + Intronic
1086762090 11:90644369-90644391 TACCAGGGGTCCCCAACCCCTGG + Intergenic
1087259961 11:96000277-96000299 TTTCAAGGGTCAGCAAACTATGG + Intronic
1087459673 11:98430116-98430138 TTTCAGGGGTCCCAAACACCTGG + Intergenic
1088367906 11:109058319-109058341 TTCCAGGGGGCCCCAAACCTGGG + Intergenic
1088910523 11:114187668-114187690 TGTCAGGGGTCCCCAACCCTGGG + Intronic
1089716132 11:120361165-120361187 TAGCAGGGGTCCCCAACCCCTGG + Intronic
1090992979 11:131837664-131837686 TTTCAACGGGCCCCAACTCCTGG + Intronic
1202825562 11_KI270721v1_random:87818-87840 TTTCCTGGGACCCCAAACTCTGG + Intergenic
1091755231 12:3047023-3047045 TATCAGAGGTCCCCAACCCCTGG + Intergenic
1091858173 12:3755676-3755698 TGTCAGGGGTCCCCAACCCCAGG - Intronic
1092766247 12:11855492-11855514 TTACTAGGGACCTCAAACCCTGG + Intronic
1092776171 12:11946761-11946783 TAGCACGGGTCCCCAATCCCTGG + Intergenic
1093752101 12:22811575-22811597 TGTCAAGGGTCCACAATCCAGGG - Intergenic
1093832289 12:23776889-23776911 GATCAGGGGTCCCCAACCCCTGG - Intronic
1094075169 12:26464547-26464569 GATCAGGGGTCCCCAACCCCCGG - Intronic
1094410251 12:30160681-30160703 CATCAGGGGTCCCCAACCCCTGG + Intergenic
1094621575 12:32085315-32085337 TTTCAATGGGCCCTGAACCCAGG + Intergenic
1096483427 12:51958883-51958905 GATCAGGGGTCCCCAACCCCTGG - Intronic
1097034832 12:56116895-56116917 TTTCAAGGGTGCCCAAGAGCTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097626045 12:62001748-62001770 TATTAGGGGTCCCCAACCCCTGG - Intronic
1097809949 12:64007545-64007567 TATCAGGGGTCCCCAACCCTTGG - Intronic
1098144492 12:67484918-67484940 TATCAGGGCTCCCCAACCCCCGG + Intergenic
1098584400 12:72138848-72138870 TTTCAATGGTCCCGAAACAGAGG + Intronic
1098696686 12:73567423-73567445 TTTCAGGGGTCCCCAACTCCTGG + Intergenic
1099126640 12:78767732-78767754 TATCAGGGGTCACCAAACACTGG + Intergenic
1099307924 12:80981575-80981597 GATCAGGGGTCCCCAACCCCAGG + Intronic
1099871602 12:88356441-88356463 TATCAGGGGTTCCCAACCCCTGG + Intergenic
1100269567 12:93011631-93011653 TTTCAATGGTTCCCAAATGCCGG - Intergenic
1100793224 12:98153369-98153391 TTCCAAGATTCCCCCAACCCTGG - Intergenic
1100904927 12:99286599-99286621 TTCCAAGGGTCCCCAGTTCCAGG + Intronic
1101262418 12:103046510-103046532 TTTTAGGGACCCCCAAACCCTGG + Intergenic
1101335345 12:103791627-103791649 GAGCAGGGGTCCCCAAACCCTGG + Intronic
1101659859 12:106756216-106756238 TTTCCAGGTTCCCCATTCCCAGG + Intronic
1102251435 12:111390032-111390054 CTTCAAGGGTCCCCTTCCCCTGG + Intergenic
1102601718 12:114036592-114036614 AGTCAAGGGTCCCCCACCCCCGG + Intergenic
1102638414 12:114344885-114344907 TTTCCAGGGGCCTCAGACCCTGG + Intergenic
1103214305 12:119189762-119189784 ATTCAGGGGTCCCCATCCCCCGG - Intronic
1103865334 12:124047287-124047309 AGTCAAGGGTCTCCAACCCCTGG + Intronic
1104065761 12:125304318-125304340 AAGCAGGGGTCCCCAAACCCTGG - Intronic
1104518703 12:129452912-129452934 GATCAGGGGTCCCCAACCCCCGG + Intronic
1104604225 12:130176150-130176172 TTTCAAGGGCCCCCGATCCCAGG + Intergenic
1105618995 13:22048677-22048699 TTTTAAGTGGCCCCCAACCCAGG - Intergenic
1106085764 13:26540337-26540359 CTTCAAGGGTCCAGAAACCAAGG - Intergenic
1106985505 13:35343491-35343513 GTTCAGGGGTCCCCAATCCCTGG + Intronic
1107106417 13:36648039-36648061 TATCAAGGGCCCCAAACCCCTGG - Intergenic
1108327186 13:49345550-49345572 TTTCAAGGGTCCCCTGATGCAGG - Intronic
1109111606 13:58327702-58327724 GATCAAGGGTCTCCAACCCCCGG + Intergenic
1110482427 13:75995104-75995126 GTTCAGGAGTCCCCAACCCCTGG - Intergenic
1110743585 13:79026493-79026515 TAGCAGGGGTCCCTAAACCCTGG - Intergenic
1111454619 13:88464933-88464955 TAGCAGGGGTCCCCAACCCCCGG + Intergenic
1112033013 13:95474463-95474485 TTGCAGGGGTCCCCAACCCCTGG - Intronic
1112165127 13:96910154-96910176 AGACAAGGGTCCCCAACCCCTGG + Intergenic
1112556534 13:100473402-100473424 TTTTGAGTGTCCCCAAACTCTGG + Intronic
1113609991 13:111637831-111637853 TTTCAAGGTTCCCTAGAGCCAGG - Intronic
1114219220 14:20682385-20682407 TTTCAGGGGTTCCCAACCCTTGG + Intergenic
1114362436 14:21989639-21989661 TTGAAAGAGTCCCCAATCCCTGG - Intergenic
1114598075 14:23931307-23931329 GATCAGGGGTCCCCAATCCCTGG + Intergenic
1115662489 14:35511040-35511062 TCTTAGGGGTCCCCAACCCCAGG - Intergenic
1115787562 14:36843181-36843203 ACTCAGGGGTCCCCAAACCCTGG - Intronic
1115872049 14:37815611-37815633 TACCAGGGGTCCCCAACCCCTGG + Intronic
1116200370 14:41786015-41786037 TATCAGGGGTCCCCAACCCCAGG - Intronic
1116588430 14:46740013-46740035 ATGCAGGGGTCCCCAACCCCTGG + Intergenic
1118835161 14:69472779-69472801 TGGCAGGGGTCCCCAACCCCGGG + Intergenic
1118942273 14:70348847-70348869 TTGCAGGGGCCACCAAACCCGGG + Intronic
1120924376 14:89783046-89783068 TTGTAGGGGTCCCCAACCCCTGG - Intergenic
1123038399 14:105480562-105480584 TTGCCAGGGTCCACACACCCAGG - Intergenic
1124386269 15:29210362-29210384 GATCAGGGGTCCCCAAGCCCTGG + Intronic
1124619248 15:31264721-31264743 TCCCTAGGGTCCCCAAGCCCAGG - Intergenic
1125253918 15:37740303-37740325 TTTCACTGGAGCCCAAACCCGGG - Intergenic
1126602335 15:50441241-50441263 TATCAGGGATCCCCAACCCCAGG - Intronic
1126821645 15:52510451-52510473 GGTCAAGGGTCCCCCATCCCCGG + Intronic
1126987410 15:54328660-54328682 TTCCAGGGTTCCCCAAATCCTGG + Intronic
1127148858 15:56053388-56053410 GATCAGGGGTCCCCAAACTCTGG + Intergenic
1127320119 15:57835885-57835907 TAACAAGGGTCCCCAACCCCAGG - Intergenic
1127387999 15:58482801-58482823 TTTCAAAAGCCCCCAAACCCAGG - Intronic
1128414301 15:67430058-67430080 TTTCTAGGGTACCAAAATCCTGG - Intronic
1129279253 15:74470955-74470977 TGTCAGGGGTCCTCAACCCCAGG - Intergenic
1129886100 15:79038147-79038169 TATCAGGGGTCCCCAATCCCTGG - Intronic
1131295366 15:91143349-91143371 TTTCAATGGTCCCCAGACCTGGG - Intronic
1131349938 15:91690285-91690307 TTACAGGGGTCCCCAACCCCCGG - Intergenic
1131612130 15:93976375-93976397 TTCCAAGGGTCCAAAAACCAGGG + Intergenic
1134286024 16:12862654-12862676 ATGCAGGGGTCCCCAAACCCCGG - Intergenic
1136290486 16:29268544-29268566 TGGCATGGGTCCCCCAACCCTGG + Intergenic
1136390216 16:29959564-29959586 AGTCAGGGGTCCCCAACCCCTGG - Intronic
1138477476 16:57280333-57280355 TTTCAAGCCTCCCCAAGCCGTGG - Intronic
1138525484 16:57603752-57603774 ATTCAGGGGTCCCCAACCCCCGG + Intergenic
1141386246 16:83624686-83624708 GGGCAAGGGTCCCCAACCCCTGG - Intronic
1141400318 16:83741781-83741803 CATCAGGGGTCCCCAACCCCTGG + Intronic
1141911075 16:87058550-87058572 TTTCTAAGATCTCCAAACCCAGG - Intergenic
1142096369 16:88242065-88242087 TGGCATGGGTCCCCCAACCCTGG + Intergenic
1142822769 17:2484983-2485005 TTACAGGAGTCCCCAACCCCTGG + Intronic
1144043293 17:11431742-11431764 TTTCAAGGGTACCCCATGCCCGG - Intronic
1146064901 17:29626681-29626703 CGTCAAGGGACCCCACACCCTGG + Exonic
1146708503 17:35020251-35020273 GATCAAGGGTCCCCAACCCCTGG + Intronic
1147475707 17:40709795-40709817 AGTCAGGGGTCCCCAATCCCTGG + Intergenic
1147505881 17:41016845-41016867 TCTCAGGGGTCCCCAAGCCCCGG - Intronic
1147930517 17:43977643-43977665 TTTCAAGGGACCCCAGAACTGGG - Intronic
1148123820 17:45226821-45226843 GTTCAAGGGTCCCCACAGCTGGG - Intronic
1148531532 17:48398054-48398076 TATCAGGAGTCCCCAACCCCTGG + Intronic
1149284523 17:55147471-55147493 ATTCAGGGGTCCTCAACCCCCGG - Intronic
1149897639 17:60441331-60441353 ATGCAGGGGTCCCCAACCCCCGG - Intergenic
1150199873 17:63344005-63344027 CATCAGGGGTCCCCAATCCCTGG + Intronic
1150344108 17:64391018-64391040 TGAGAAGGGCCCCCAAACCCAGG - Intronic
1150498249 17:65625788-65625810 ATCCAGGGGTCCCCAACCCCCGG + Intronic
1151263666 17:72937003-72937025 CCGCAAGGGTCCCCAACCCCTGG - Intronic
1152621118 17:81365364-81365386 AGTCAGGGGTCCCCAACCCCTGG - Intergenic
1152666881 17:81575723-81575745 CTTCAAGGTTCCCCAAAGGCAGG - Intronic
1152760633 17:82105507-82105529 TTTCCAGGGTCCCCACGCCTGGG + Intronic
1152988423 18:340417-340439 TTTCAAGGCTCCCAGAACCGTGG - Intronic
1153021746 18:635469-635491 TAGCAGGGGTCCCCAACCCCTGG - Intronic
1153701488 18:7698940-7698962 AATCAGGGGTCCCCAACCCCTGG + Intronic
1153953816 18:10079114-10079136 CATCAGGGGTCCCCAACCCCAGG + Intergenic
1155164279 18:23220007-23220029 TTTCCAGTGTTCCCAAGCCCAGG - Intronic
1156562880 18:38148580-38148602 TTTTTAGGGTCCCTAAACCTTGG - Intergenic
1157468509 18:47969261-47969283 TGGCAGGGGTCCCCAACCCCCGG + Intergenic
1157691657 18:49687328-49687350 AGTCAGGGGTCCCCAATCCCCGG - Intergenic
1157870128 18:51222563-51222585 ATGCAGGGGTCCCCAACCCCTGG + Intergenic
1158289555 18:55923842-55923864 TGTCAGGGGTCCCCAACCCCTGG - Intergenic
1158405836 18:57158329-57158351 ATTCACGGGTCCCCAGAACCTGG - Intergenic
1158810068 18:61021723-61021745 TAGCAGGGGTCCCCAACCCCTGG + Intergenic
1159285381 18:66342857-66342879 AATCAAGGGTCCCCAACCCCTGG - Intergenic
1159604966 18:70465817-70465839 TATCAGGGGTCCCCAAGTCCCGG + Intergenic
1160357957 18:78244536-78244558 TTCCAAGGGTCCCCTCTCCCTGG - Intergenic
1162582353 19:11539044-11539066 GTTCAAGGGACCCCAAGCTCAGG - Intronic
1162644138 19:12036143-12036165 TGGCAGGGGTCCCCAACCCCCGG - Intronic
1162705019 19:12549274-12549296 TTTCAAGGGTTTACAAACCCAGG + Intronic
1163067778 19:14811944-14811966 GTGCAGGGGTCCCCAACCCCTGG - Intronic
1163391151 19:17030766-17030788 AATCAAGGGTCCCCAACCCCTGG - Intergenic
1163501089 19:17676648-17676670 TTTGAGGCTTCCCCAAACCCTGG - Intronic
1163508100 19:17719901-17719923 CTGCAAGGGTCCCCAAGCCCAGG - Intronic
1164796975 19:31041323-31041345 TTTCAGGTGCCCCCAAAGCCTGG + Intergenic
1165242420 19:34479505-34479527 GATCAGGGGTCCCCAACCCCTGG + Intergenic
1165848773 19:38836816-38836838 TTTGGAGGCTCCCCAAACCCAGG + Intronic
1166688184 19:44808461-44808483 TTTCAATGGTCTTCAAATCCAGG - Intergenic
1168561173 19:57384639-57384661 AATCAGGGGTCCCCAACCCCTGG + Intronic
926177169 2:10604244-10604266 TACCAGGGGTCCCCAACCCCTGG - Intronic
926286596 2:11493588-11493610 ATTCAGGGGTCCCCAGTCCCCGG - Intergenic
926844797 2:17124323-17124345 TTTCAAGGGCTCACAAAGCCAGG + Intergenic
927259501 2:21072741-21072763 GATCAGGGGTCCCCAAGCCCAGG - Intergenic
927339583 2:21966915-21966937 TAGCAAGGGTACCCAAACCCAGG - Intergenic
927865185 2:26583515-26583537 TTTCCAGGGTCCCCAGAACACGG - Intronic
928613785 2:33016533-33016555 TTTTAAAACTCCCCAAACCCAGG - Intronic
929070265 2:38021911-38021933 TAGCAGGGGTCCCTAAACCCCGG - Intronic
929254843 2:39799106-39799128 TCTCAAGGGTTCCCAAACCATGG + Intergenic
929476156 2:42251164-42251186 TACCAGGGGTCCCCAACCCCTGG - Intronic
929813974 2:45216198-45216220 ACTCAAGGGTTCCCAATCCCTGG - Intergenic
930007551 2:46910133-46910155 TTCCAAGTGTGGCCAAACCCTGG - Intronic
930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG + Intergenic
930901878 2:56517060-56517082 TTCCAAGGTTCCCCCAACCAGGG + Intergenic
931597805 2:63969271-63969293 TCTCAGTGGTCCCCAACCCCTGG + Intronic
935129768 2:100253030-100253052 TTGCAAAGGTTCCCAAACCTTGG - Intergenic
936293627 2:111248287-111248309 TATCAACTGTCCCCATACCCAGG - Intergenic
937159785 2:119749295-119749317 TGTCAAGGGTCCTCCATCCCAGG - Intergenic
938449564 2:131405027-131405049 AGTCAGGGGTTCCCAAACCCTGG - Intergenic
939306298 2:140415994-140416016 GTGCAGGGGTCCCCAACCCCTGG + Intronic
940300823 2:152175375-152175397 CTTTGAGGGTCCCCAAACTCAGG + Intronic
940312319 2:152291850-152291872 GATCAGGGGTCCCCAACCCCAGG + Intergenic
940511132 2:154616757-154616779 CAGCAAGGATCCCCAAACCCCGG + Intergenic
941002720 2:160218692-160218714 GTACAGGGGTCCCCAACCCCTGG + Intronic
941367261 2:164622830-164622852 TACCAGGGGTCCCCAACCCCTGG + Intergenic
941488956 2:166119181-166119203 GATTAAGGGTCCCCAAACCCTGG - Intronic
941876157 2:170435448-170435470 TTTCAGGAGTCTCCAAGCCCAGG - Intronic
944161243 2:196662650-196662672 TTACAGGGGTCGCCAACCCCTGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944870988 2:203911579-203911601 ATTCAGGGGACCCCAACCCCAGG - Intergenic
944884330 2:204047482-204047504 TAGCAGGGGTCCCCAACCCCTGG - Intergenic
945027322 2:205631453-205631475 TGTCAGAGGTCCCCAACCCCTGG - Intergenic
945504837 2:210627254-210627276 TTTCAAGGGTACAAAGACCCAGG + Intronic
946739836 2:222790509-222790531 TACCAGGGGTCCCCAACCCCTGG - Intergenic
947609187 2:231512494-231512516 TGCCAGGGGTCCCCAAGCCCTGG - Intergenic
948535728 2:238645200-238645222 TAACAGGGGTCCCCAATCCCTGG + Intergenic
1168732221 20:94669-94691 TAGCAGGGGTCCCCAACCCCTGG - Intronic
1168784022 20:521955-521977 TATCAGGGGTCCCCAATCCCCGG + Intronic
1169482903 20:6001381-6001403 TTACAGGGGTCCCCAACCCCTGG - Intergenic
1170195860 20:13688973-13688995 TGTCAGGGGTCCCCCACCCCTGG + Intergenic
1170338792 20:15300387-15300409 TTTTAAAAATCCCCAAACCCAGG - Intronic
1170940088 20:20841599-20841621 TGTCAGGGGTCCTCAATCCCTGG + Intergenic
1172850563 20:37959976-37959998 TATCAGGGGTCTCCAACCCCTGG + Intergenic
1172963483 20:38816029-38816051 TTTCAAGCCTCCTCACACCCTGG - Intronic
1173665816 20:44762293-44762315 GGTCAGGGGTCCCCAACCCCAGG - Intronic
1174035926 20:47668221-47668243 ATTCAGGGGTCCCTAAACCATGG + Intronic
1174093471 20:48068390-48068412 GGACAAGGGTCCCCAATCCCTGG - Intergenic
1174678987 20:52386293-52386315 GGTCAGGGGTCCCCAACCCCTGG + Intergenic
1175203622 20:57294284-57294306 TAACAGGGGTCCCCAACCCCTGG - Intergenic
1175786543 20:61715698-61715720 TCTCAGGGGTCCCCAGACTCCGG - Intronic
1177319193 21:19498450-19498472 TGGCAGGGGTCCCCAACCCCTGG + Intergenic
1177538733 21:22463887-22463909 ATACAGGGGTCCCCAAACCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178325308 21:31640983-31641005 ACTCAAGGGTCCCCAATCCCTGG - Intergenic
1178744621 21:35237082-35237104 GGTCAAGGGTCCCCAACCCCTGG + Intronic
1178885368 21:36480614-36480636 TTGAGAGGGTCCCCAAACCTTGG - Intronic
1178999174 21:37439451-37439473 TCACAAGGGTCCCCAACCCCTGG + Intronic
1179256454 21:39720410-39720432 TTCCAGGGGTCCCCAACCCCTGG - Intergenic
1179799613 21:43804819-43804841 ATTCGAGTGTCCCCCAACCCCGG + Exonic
1181524652 22:23473523-23473545 CTTCAAGGCTCCCCAAACAAGGG + Intergenic
1183570943 22:38652947-38652969 AATCAGGGGTCCCCAACCCCAGG + Intronic
1183621506 22:38975774-38975796 GAGCAAGGGTCCCCAACCCCCGG + Intronic
1183734912 22:39639012-39639034 AAGCAGGGGTCCCCAAACCCCGG - Intronic
1183756599 22:39772372-39772394 GTCCAGGGGTCCCCAACCCCTGG - Intronic
1184042346 22:41951591-41951613 TTGCAAGGGTCCTGAAAGCCAGG + Intergenic
1184565724 22:45290640-45290662 TATCAGGGGTCCCCAACCCCTGG + Intronic
949354023 3:3158373-3158395 TGGCAGGGGTCCCCAAATCCTGG - Intronic
949475459 3:4441012-4441034 TAGCAAGGGTCCCCAACCCCTGG + Intronic
949925389 3:9037126-9037148 TTTCCAGTGGCCCCAAATCCTGG - Intronic
949962277 3:9322427-9322449 ATACAGGGGTCCCCAACCCCTGG + Intronic
950160308 3:10755758-10755780 TTGCAAGTGTCCCCTCACCCAGG + Intergenic
950624974 3:14238591-14238613 TGCCAGGGGTCCCCAACCCCTGG - Intergenic
950886673 3:16368267-16368289 TTACAAAGTTCCCCAAAGCCAGG - Intronic
950972164 3:17200277-17200299 GTTCAGGGGTCCCCAAACCCCGG + Intronic
951480700 3:23159370-23159392 AATCAGGGGTCCCCAACCCCCGG - Intergenic
951709675 3:25575319-25575341 GGTCAGGGGTCCCCAAGCCCTGG - Intronic
952021730 3:29031007-29031029 TTTCAGTGCTCCCCCAACCCCGG + Intergenic
952635400 3:35523081-35523103 GACCAGGGGTCCCCAAACCCGGG - Intergenic
953785600 3:45908827-45908849 ATGCAGGGGTCCCCAACCCCTGG + Intronic
954395831 3:50292765-50292787 TTCCCATGGTCCCCAGACCCAGG - Exonic
954454005 3:50587198-50587220 CTCCAAGGGTCCACAAGCCCAGG - Intergenic
955047818 3:55376537-55376559 AGTCAAGGGTCCCCAACCCCTGG + Intergenic
955097499 3:55814182-55814204 ATTCAAGGGTCCCAAAATTCAGG + Intronic
956104363 3:65801805-65801827 AAGCAGGGGTCCCCAAACCCCGG + Intronic
956647831 3:71474420-71474442 GTTCAGGGGTCCCCAGTCCCCGG + Intronic
956778416 3:72585888-72585910 TTTCTGGGGTCCTCAGACCCAGG - Intergenic
958263445 3:91408952-91408974 TATCAGAGGTCCCCAACCCCTGG - Intergenic
959321961 3:104887897-104887919 AATCAAAGGTCCCCAAACCCTGG - Intergenic
960020694 3:112948694-112948716 TATCACGGGTCCCCAACCCTGGG - Intronic
960225103 3:115159009-115159031 GTGAAAGGGTCCCCAACCCCTGG + Intergenic
961488728 3:127235979-127236001 ATGCAGGGGTCCCCAACCCCTGG + Intergenic
961824381 3:129591331-129591353 TTTAAAGTGTTCCCAAACGCCGG + Intronic
962110735 3:132444019-132444041 TTGCAGGGGCCCCCAAGCCCAGG + Intronic
962574661 3:136745706-136745728 AATCAAGGGTCCCCAACCACTGG - Intronic
962805311 3:138922883-138922905 TATCAGGGGTCCCCAATCCCCGG - Intergenic
962845595 3:139271068-139271090 TTTCAGTGGACCCCAAAGCCAGG - Intronic
963676405 3:148316788-148316810 TTTCAGGGGTCCCTAGCCCCAGG - Intergenic
964784044 3:160373954-160373976 TGTCAGGGGTCCCCAACCCTTGG - Intronic
965435700 3:168648443-168648465 TGTCAAGGATCCCCAAACCTCGG + Intergenic
966802125 3:183774198-183774220 GATCAGGGGTCCCCAACCCCTGG + Intronic
967079132 3:186032900-186032922 TGTCAGGGGTCCCCAACCCTCGG + Intergenic
967250937 3:187537128-187537150 ATGCAGGGGTCCCCAACCCCCGG - Intergenic
968331472 3:197874136-197874158 GTGCAGGGGTCCCCAACCCCTGG + Intronic
968344429 3:197989164-197989186 TTTCAAGGCTGCCCAAAAGCTGG + Intronic
968705403 4:2075261-2075283 TTTCAAGGGTCCCCAAACCCAGG + Intronic
969347256 4:6577096-6577118 CATCAAGGGTCACCAGACCCTGG - Intronic
969499238 4:7543082-7543104 TTCCAAGGCCCCCCAAAACCTGG - Intronic
972187312 4:36545529-36545551 AAGCAAGGGTCCCCAACCCCTGG - Intergenic
972278512 4:37581701-37581723 TGTCACGTGTCCCAAAACCCAGG - Intronic
973095931 4:46199915-46199937 GGTCAGGGGTCCCCAACCCCTGG + Intergenic
973886373 4:55326077-55326099 TTTCAAGTTTCCCCAAATCCTGG + Intergenic
975625092 4:76337894-76337916 GAACAAGGGTCCCCAAACCCTGG + Intronic
976082743 4:81374966-81374988 TGTCAAGATTCCCCAAGCCCTGG + Intergenic
976703057 4:87992007-87992029 TTACAGGGGTCTCCAACCCCCGG - Intergenic
976869097 4:89768829-89768851 AATCAGGGGTCCCCAACCCCAGG - Intronic
977910158 4:102524961-102524983 GTGCAGGCGTCCCCAAACCCTGG - Intronic
978174712 4:105716413-105716435 TAGCAAGGGTCCCCAACCCCTGG + Intronic
978291974 4:107152415-107152437 GATCAGGGGTTCCCAAACCCCGG - Intronic
978546640 4:109878027-109878049 TTTAAAGTTTCCCCAAAGCCAGG - Intergenic
978754533 4:112287531-112287553 TGGCAAGGGTCCCCAACCTCTGG - Intronic
978858598 4:113422673-113422695 TTTCAAGAGTCCACAGGCCCAGG + Intergenic
979489495 4:121308982-121309004 CAGCAAGGGTCCCCAACCCCCGG + Intergenic
980016608 4:127657447-127657469 GAGCAGGGGTCCCCAAACCCTGG + Intronic
980508265 4:133752294-133752316 TTTCAGGGGTCCCCAACCCCTGG + Intergenic
980579326 4:134729552-134729574 TTTCAAGGGTTCACAACCCCTGG + Intergenic
980646703 4:135652177-135652199 TTCTTAGGGTCCCCAATCCCAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981721871 4:147809869-147809891 TAGCAGGGGTCCCCAAGCCCTGG - Intronic
982105992 4:152012571-152012593 AGTCAGGGGTCCCCAACCCCAGG + Intergenic
983208017 4:164931515-164931537 GTACAGGGGTCCCCAAACCCTGG - Intergenic
983251859 4:165354509-165354531 GTTCAAGGGTTCCCAATCCCCGG - Intergenic
983811280 4:172065420-172065442 GTGCAGGGGTCCCCAACCCCTGG - Intronic
984609336 4:181819867-181819889 GATCAGGGGTCCCCAACCCCTGG - Intergenic
984814348 4:183822768-183822790 TCACAGGGGTCCCCAACCCCTGG - Intergenic
985005706 4:185533466-185533488 TCCCAAGTGTCCCCAAAGCCAGG - Intronic
986207383 5:5637922-5637944 TTTAGAGGGACCCCAAATCCAGG - Intergenic
986208950 5:5652276-5652298 TTACAGGGGTCCACAACCCCTGG + Intergenic
986315493 5:6583703-6583725 TTCCAAAGGTCCCAGAACCCAGG - Intergenic
986835084 5:11628068-11628090 AAGCAAGGGTCCCCAACCCCTGG - Intronic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987942246 5:24554226-24554248 TTTCCAAGGTCCTGAAACCCAGG + Intronic
989163619 5:38414076-38414098 TATCAGGGGTCCCCAACCCCTGG - Intronic
990247135 5:53874248-53874270 GTGCAGGGGTCCCCAACCCCAGG - Intergenic
990397229 5:55394690-55394712 ATTCAGGGGTCCCCAAGCCCCGG - Intronic
991160422 5:63492732-63492754 ATGCAGGGGTCCCCAACCCCAGG + Intergenic
992096405 5:73366843-73366865 AATCAGGGGTCTCCAAACCCTGG - Intergenic
992348991 5:75910284-75910306 TTTCCATGGTCCTCACACCCTGG + Intergenic
992716981 5:79520658-79520680 TATCAGGGGTCCCCAACCCCTGG - Intergenic
993140328 5:84025206-84025228 GTCCAGGGGTCCCCAACCCCTGG + Intronic
993342162 5:86738310-86738332 AAACAAGGGTCCCCAACCCCTGG - Intergenic
993690222 5:90990637-90990659 CTTTAGGGGTCTCCAAACCCAGG - Intronic
993923076 5:93831205-93831227 GAACAAGGTTCCCCAAACCCCGG - Intronic
994024528 5:95067076-95067098 CTTCAAGAGTCCCCCATCCCAGG - Intronic
994059888 5:95463048-95463070 CTTCCAGGGACCTCAAACCCAGG - Intergenic
994604075 5:101944135-101944157 TAGCAGGGGTCCCCAACCCCTGG + Intergenic
996331231 5:122331203-122331225 AATCAGGGGTCCCCAATCCCTGG - Intronic
996869298 5:128168884-128168906 TACCAAGGGTCCCCAATACCTGG - Intronic
997281166 5:132646858-132646880 GATCAGGGGTCCCCAACCCCCGG - Intergenic
997415095 5:133722069-133722091 TTGCAGGGATCCCCAACCCCTGG + Intergenic
997811531 5:136975062-136975084 GAACAGGGGTCCCCAAACCCTGG - Intergenic
998481580 5:142467533-142467555 GGGCAGGGGTCCCCAAACCCTGG + Intergenic
998840239 5:146245686-146245708 GAGCAGGGGTCCCCAAACCCCGG + Intronic
1000146227 5:158455660-158455682 ATTCAACGGTTTCCAAACCCAGG - Intergenic
1000603983 5:163308324-163308346 TTACAGGGGTCCCCAACTCCGGG - Intergenic
1001087283 5:168709410-168709432 TTTTAAAAGTCCCCACACCCAGG + Intronic
1001350934 5:170963794-170963816 TGACAAGGGTCCCCAAACCCTGG - Intronic
1001589707 5:172856973-172856995 TTTCCAGGGGCCCCAACCCTTGG - Intronic
1002650634 5:180690598-180690620 AATCAGGGGTCCCCAACCCCTGG + Intergenic
1002838823 6:888139-888161 TGACAAGCGTTCCCAAACCCGGG + Intergenic
1002859305 6:1065953-1065975 TTTCATGGGTGCCCCAACCAAGG - Intergenic
1003007231 6:2393139-2393161 ATGCAGGGGTCCCCAACCCCTGG - Intergenic
1003277765 6:4666990-4667012 GCACAAGGGTCCCCAACCCCTGG + Intergenic
1004501090 6:16210790-16210812 TATCAGGGGTCCCCAATCCCTGG - Intergenic
1004860630 6:19801373-19801395 TCTCAGGGGTCCCCAAGTCCTGG + Intergenic
1005660513 6:27994222-27994244 AATCAGGGGTCCCCAACCCCTGG + Intergenic
1006612432 6:35302413-35302435 TTTTATGGATTCCCAAACCCTGG + Intronic
1008596179 6:53044130-53044152 AAGCAGGGGTCCCCAAACCCAGG + Intronic
1008991988 6:57614024-57614046 TATCAGAGGTCCCCAACCCCTGG + Intronic
1009180587 6:60512966-60512988 TATCAGAGGTCCCCAACCCCTGG + Intergenic
1009532297 6:64833971-64833993 TTTGAATGGGCCCCAAACCAGGG + Intronic
1009962075 6:70535346-70535368 AACCAGGGGTCCCCAAACCCTGG + Intronic
1010010313 6:71041050-71041072 TTACAAGGGTCCCCAGAGACAGG - Intergenic
1011637658 6:89389115-89389137 TGTCAGGGATCCCCAAACCCCGG - Intronic
1011833152 6:91398379-91398401 TATCATGAGTCCCCAACCCCAGG + Intergenic
1012593194 6:101008387-101008409 TTTAAAGGGTCCTGATACCCTGG - Intergenic
1013826322 6:114215371-114215393 TTGCATGGGACCCCGAACCCTGG + Intronic
1013923046 6:115432885-115432907 GGACAAGGGCCCCCAAACCCTGG - Intergenic
1014213062 6:118727016-118727038 TTTTATGAGTCCCCAAACCATGG - Intergenic
1014350760 6:120342426-120342448 TTACAGGTGTCCCCAACCCCTGG + Intergenic
1014600088 6:123400637-123400659 GAGCACGGGTCCCCAAACCCTGG - Intronic
1015537018 6:134276716-134276738 TTCCAGGGGTCTCCAAACCCGGG + Intronic
1015827636 6:137331722-137331744 TTTCATGGCTCTCCAATCCCAGG + Intergenic
1016107058 6:140175862-140175884 TTTCAAGGGTTCCAAAATGCAGG - Intergenic
1016881293 6:148914766-148914788 TTTCAGGGATCCCCCACCCCTGG - Intronic
1017318280 6:153058000-153058022 AGTCAGGGGTCCCCAACCCCTGG - Intronic
1017423349 6:154295760-154295782 TTGCAAGAGTCCCAAAGCCCTGG - Intronic
1018420134 6:163633924-163633946 TCCCAATGATCCCCAAACCCTGG - Intergenic
1019893879 7:3967863-3967885 AATCAGGGGTCCCCAAGCCCTGG - Intronic
1020972929 7:14969435-14969457 CTACAGGGGTCCCCAACCCCAGG + Intronic
1021284198 7:18759211-18759233 TATCAGGGGTCCCCAAACCCTGG + Intronic
1021823105 7:24517708-24517730 TTGCAAGGGTCTCAAAACTCAGG - Intergenic
1022579357 7:31533878-31533900 GGTCAGGGGTCCCCAACCCCAGG + Intronic
1023277535 7:38535913-38535935 GATCAAGGGTCCCCAAACCCTGG - Intronic
1023327041 7:39071451-39071473 TGCCAAGGGTCCCCAACCCTTGG - Intronic
1023728725 7:43170008-43170030 ATGCAGGGGTCCCCAACCCCCGG + Intronic
1023941537 7:44771462-44771484 TCTCAATGGCCCCCAAAGCCTGG - Intergenic
1024322016 7:48079991-48080013 TGCCAGGGGTCCCCAATCCCTGG + Intergenic
1024351879 7:48374757-48374779 GATCAGGGGTCCCCAACCCCTGG + Intronic
1024613964 7:51091954-51091976 TCTCAGGGGTTCCCAAACCCTGG + Intronic
1025738212 7:64173790-64173812 TGTCAAGGGACCCCACGCCCTGG + Intronic
1026224046 7:68425268-68425290 AATCAGGGGGCCCCAAACCCTGG + Intergenic
1026315133 7:69221282-69221304 CCTCAGGGGTCCCCAACCCCTGG - Intergenic
1027426691 7:78068372-78068394 TATCAGGGGTCCCCAACCCCTGG - Intronic
1028173954 7:87631329-87631351 TTTCCAGAGTCACCAAACCCTGG + Intronic
1028903814 7:96131110-96131132 TTTCAAGGGTCCCTAAGAGCAGG - Intronic
1029019569 7:97350371-97350393 GTACATGGGTCCCCAACCCCTGG + Intergenic
1030323232 7:108192097-108192119 GAGCACGGGTCCCCAAACCCTGG + Intronic
1031393725 7:121247549-121247571 TGTCCAGGGTACCCAAACACTGG + Intronic
1031574769 7:123401567-123401589 AACCAGGGGTCCCCAAACCCTGG - Intergenic
1031945215 7:127832715-127832737 GAGCAAGGGTCCCCAAGCCCCGG + Intronic
1032587851 7:133164068-133164090 AAACAGGGGTCCCCAAACCCCGG - Intergenic
1034441562 7:151088202-151088224 TTTCAGAGGTCCCCATAGCCGGG + Intronic
1034734276 7:153413790-153413812 TTTCATTGGTGCCGAAACCCGGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036431676 8:8697962-8697984 GTGCAGGGGTCCCCAACCCCTGG + Intergenic
1037490664 8:19394312-19394334 GGTCAGGGGTCCCCAACCCCAGG - Intronic
1037498660 8:19464532-19464554 TTCCAGGGGTCCCCAAGCCACGG + Intronic
1038420056 8:27428337-27428359 TAGCAAAGGTCCCCAACCCCTGG - Intronic
1038681263 8:29670570-29670592 AAGCAGGGGTCCCCAAACCCTGG + Intergenic
1038863653 8:31414944-31414966 TAGCAGGGGTCCCCAATCCCTGG - Intergenic
1038901408 8:31848483-31848505 ATACAAGGGTCCACAACCCCTGG + Intronic
1039375501 8:37028718-37028740 GAGCAAGGGTCCCCAATCCCTGG + Intergenic
1040031106 8:42824465-42824487 ATTCAGGGGTCCCCAACCCCAGG - Intergenic
1041586879 8:59530946-59530968 TTTAAAGTGTCCCCAAAGCTGGG - Intergenic
1042159907 8:65882193-65882215 TTGCAGGGGCCCCCAACCCCTGG + Intergenic
1042981437 8:74533233-74533255 TGTTAGGGGTCCCCAACCCCGGG - Intergenic
1043685938 8:83086275-83086297 TTTCAATGTTCCCCAATGCCAGG - Intergenic
1044261888 8:90134549-90134571 TTTCAGGGGTCCCCAACCCCTGG - Intergenic
1044995659 8:97835838-97835860 GATCAGGGGTCCCCAAGCCCCGG + Intronic
1045602371 8:103732589-103732611 TTTCAAGGGTTCCCAACTCCAGG - Intronic
1045951286 8:107854401-107854423 TTTCAAGGGTCAACAAGCCATGG + Intergenic
1046237947 8:111451713-111451735 TTTCAGGGGTCCCTAACCCCCGG + Intergenic
1046526728 8:115390157-115390179 GATCAAGGGTCCCCAACCCCTGG - Intergenic
1048231155 8:132643195-132643217 GCACAGGGGTCCCCAAACCCTGG - Intronic
1048480217 8:134783236-134783258 AGTCAAGGGTCCCCATCCCCTGG + Intergenic
1049132715 8:140862561-140862583 CCTCAAGGTTCCCCAAACCCTGG + Intronic
1049918482 9:341703-341725 GGTCAGGGGTCCCCAACCCCCGG + Intronic
1050131285 9:2415244-2415266 TATCAGGAGTCCCCAACCCCTGG - Intergenic
1050871181 9:10571976-10571998 TATCAGGTGTCCCCAACCCCTGG - Intronic
1050988881 9:12120862-12120884 TATCAGGAGTCCCCAACCCCAGG + Intergenic
1051332053 9:16033228-16033250 TTATAGGGGTCCCCAACCCCTGG + Intronic
1052783211 9:32802170-32802192 TAGCTGGGGTCCCCAAACCCTGG - Intergenic
1054719064 9:68585441-68585463 TTTCAGGGGTCCCCAACCCTCGG + Intergenic
1057383660 9:94589909-94589931 TTTCAGGGGACCACAAACACAGG + Intronic
1057932461 9:99206960-99206982 TGTCAGGGGTCCCCAGACCCTGG + Intergenic
1058014581 9:100015989-100016011 GAACAAGGGTCCCCATACCCTGG - Intronic
1059009854 9:110445153-110445175 TTTAAAGGGACCACAAACGCTGG + Intronic
1059361807 9:113749404-113749426 TGTCAGGGGTCCCCAGTCCCTGG + Intergenic
1059563925 9:115363646-115363668 TTTGAAGGATCCCCCACCCCTGG - Intronic
1060860199 9:126947778-126947800 TTTAAAGCCTCCCCAAATCCAGG + Intronic
1185785095 X:2884087-2884109 TAGCAGGGGTCCCCAACCCCTGG - Intergenic
1185831797 X:3310147-3310169 TCTGGAGGGCCCCCAAACCCTGG - Exonic
1186342020 X:8655514-8655536 TCTCAAGTGTCCCCAATCCTAGG - Intronic
1188674546 X:32922743-32922765 AAGCAGGGGTCCCCAAACCCTGG - Intronic
1188692658 X:33149501-33149523 CTGCAGGGGTCCCCAACCCCTGG - Intronic
1188700249 X:33250505-33250527 ATACAAGGGTCCCCAACCCCTGG - Intronic
1189148701 X:38682855-38682877 TTTAGAGGATCCCCAAACCCTGG + Intronic
1191129114 X:56989501-56989523 GTGCAGGGGTCCCCAACCCCTGG + Intronic
1191151318 X:57223197-57223219 TTGCAGGGGCCACCAAACCCCGG + Intergenic
1191192568 X:57682183-57682205 TTTCAAAAGTGGCCAAACCCAGG + Intergenic
1193687027 X:84590126-84590148 TTTCAAAGATCCACAAATCCAGG + Intergenic
1193869099 X:86775262-86775284 GTTCAGGGGTCCCCAACCTCTGG + Intronic
1193909558 X:87285721-87285743 TTTCAAGGATCCCTAAATTCAGG + Intergenic
1193928252 X:87517969-87517991 TTTCAAGGTTCCACCAACACTGG + Exonic
1194786271 X:98087596-98087618 TCACATGTGTCCCCAAACCCCGG - Intergenic
1194832787 X:98645690-98645712 ATTCAGGGGTCCCCAACCCCAGG + Intergenic
1195640015 X:107163043-107163065 TATCAGGGGTCCTCAACCCCTGG - Intronic
1197985780 X:132265474-132265496 TGACAGGGGTCCCCAACCCCAGG + Intergenic
1199886183 X:152024233-152024255 ATCCAGGGGTCCCCAAACCCTGG + Intergenic
1200368517 X:155694966-155694988 AAGCAAGGGTCCCCAATCCCTGG - Intergenic
1200841023 Y:7781975-7781997 CATCAAGGGTCCCCAAACCTGGG + Intergenic
1200872783 Y:8121423-8121445 GATCAGGGTTCCCCAAACCCTGG - Intergenic
1200886543 Y:8277894-8277916 GATCAAGGATCCCCAAACCCTGG + Intergenic
1200951889 Y:8905446-8905468 GATCAAGGATCCCCAAACACTGG - Intergenic
1201052443 Y:9950785-9950807 GATCACGGATCCCCAAACCCTGG - Intergenic
1201244203 Y:11986933-11986955 TCTGGAGGGCCCCCAAACCCTGG + Intergenic
1201769954 Y:17610067-17610089 TTTCATTGGTGCCGAAACCCAGG + Intergenic
1201831600 Y:18295920-18295942 TTTCATTGGTGCCGAAACCCAGG - Intergenic
1202101321 Y:21310519-21310541 GATCAGGGATCCCCAAACCCTGG - Intergenic
1202161071 Y:21937887-21937909 GATCAAGGATCCCCAAACACTGG + Intergenic
1202187202 Y:22197679-22197701 GATCAGGGATCCCCAAACCCTGG - Intergenic
1202204158 Y:22388717-22388739 GATCAGGGATCCCCAAACCCTGG + Intronic
1202230285 Y:22648486-22648508 GATCAAGGATCCCCAAACACTGG - Intergenic
1202241057 Y:22770540-22770562 GATCAGGGATCCCCAAACCCTGG + Intergenic
1202312871 Y:23547679-23547701 GATCAAGGATCCCCAAACACTGG + Intergenic
1202394043 Y:24404283-24404305 GATCAGGGATCCCCAAACCCTGG + Intergenic
1202476742 Y:25265809-25265831 GATCAGGGATCCCCAAACCCTGG - Intergenic
1202557931 Y:26122915-26122937 GATCAAGGATCCCCAAACACTGG - Intergenic