ID: 968706653

View in Genome Browser
Species Human (GRCh38)
Location 4:2081465-2081487
Sequence CCTGCCTGGCAGTTACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968706653_968706659 7 Left 968706653 4:2081465-2081487 CCTGACAGTAACTGCCAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 968706659 4:2081495-2081517 TAGTGTAAGCTCCTGCAAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 109
968706653_968706658 4 Left 968706653 4:2081465-2081487 CCTGACAGTAACTGCCAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 968706658 4:2081492-2081514 GGGTAGTGTAAGCTCCTGCAAGG 0: 1
1: 0
2: 1
3: 7
4: 87
968706653_968706661 22 Left 968706653 4:2081465-2081487 CCTGACAGTAACTGCCAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 968706661 4:2081510-2081532 CAAGGAGGTTTGTGATGAGCAGG 0: 1
1: 1
2: 0
3: 7
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968706653 Original CRISPR CCTGCCTGGCAGTTACTGTC AGG (reversed) Intronic
900270231 1:1783201-1783223 CCTGGCTGGCAGTTCCTGGGAGG - Intergenic
900887195 1:5423449-5423471 TCTGGCTGGAAGTGACTGTCTGG + Intergenic
901301179 1:8200962-8200984 CCTGCCTGGAAGTTATGCTCAGG + Intergenic
904346928 1:29878851-29878873 CCTGTCTGGCAGTGGTTGTCTGG + Intergenic
905519087 1:38584215-38584237 CCAGCAGGGCAGGTACTGTCAGG - Intergenic
907754883 1:57301810-57301832 TCTGCCTCTCAGTGACTGTCTGG + Intronic
908825794 1:68131584-68131606 ACTGCCTGGCAGTAAGTGTCAGG - Intronic
909102364 1:71365155-71365177 CCTGTGAGGCAGATACTGTCAGG - Intergenic
915195467 1:154185748-154185770 CCTGCATGGCAGTGCCTGTAGGG - Intronic
918201216 1:182268821-182268843 CCTGGCTGTCAGTTTCTGTCAGG + Intergenic
923224932 1:231930526-231930548 CCTGCCTGGAAGTGACAGTCAGG + Intronic
923435299 1:233962469-233962491 CATGCCTGGCAATTAGTGTAAGG - Intronic
1064265525 10:13822411-13822433 CCTTCCAGGAACTTACTGTCTGG - Intronic
1065139907 10:22710296-22710318 CCTGCCAGGCAGTTTCAGGCAGG - Intronic
1068380225 10:56244261-56244283 CCTGACTGGCAGTGGCTTTCTGG + Intergenic
1069629688 10:69889974-69889996 CCTTCCTGGGAGTTTCTGTTTGG + Intronic
1072923452 10:99596000-99596022 CCTCCCTGCCAGTTGCTGCCTGG - Intergenic
1073118482 10:101107040-101107062 CCTGCCTCCCAGTTGCTGTGGGG - Intronic
1074125767 10:110527854-110527876 CCTCCCTGGCACTTCCTGACCGG - Intergenic
1074662645 10:115679114-115679136 CCTGCATGGCATGTACTCTCTGG + Intronic
1076250787 10:128982468-128982490 CCAGCCTGGCAGCCTCTGTCTGG - Intergenic
1076273246 10:129174812-129174834 CCTGCCAGGCAGTTAATGAAAGG - Intergenic
1076523558 10:131096057-131096079 CCTGCCTGCCAGGCACCGTCGGG + Intronic
1076616633 10:131759460-131759482 GCTGCCTATCAATTACTGTCTGG + Intergenic
1077025573 11:438457-438479 CCTGCCTGGCTGTGTGTGTCAGG - Intronic
1079937284 11:26633375-26633397 CCTGACTGGCAGGTAATCTCAGG - Intronic
1081744679 11:45464528-45464550 TCTCCCTGGCAGTCAATGTCAGG + Intergenic
1082980569 11:59116845-59116867 CCTGCCTGACAGTCCCAGTCTGG - Intronic
1084462271 11:69302608-69302630 CCTACCTGGCACCTACTGTGTGG - Intronic
1084786559 11:71445087-71445109 CCTGCCTGGAATCTGCTGTCAGG - Intronic
1086984580 11:93234212-93234234 TCTGTCTGGCTGTTACTGTGTGG - Intergenic
1089334754 11:117715550-117715572 CCTGCATGGAATTTACAGTCTGG + Intronic
1091171895 11:133526885-133526907 CCTGCCTGGCCCTCTCTGTCTGG + Intronic
1092936393 12:13367973-13367995 TCTGCTTGGCAGTTGCTGTCTGG + Intergenic
1096896009 12:54821264-54821286 TCTGCCTGACAGCTACTGTTTGG + Intergenic
1107181549 13:37467060-37467082 CCTGCCATGCAGTTATTGGCTGG - Intergenic
1107584312 13:41827907-41827929 CCTGCCTGGCAGTTTCTCTTAGG - Intronic
1114389811 14:22294955-22294977 CCTGTGTGGCAGATACTCTCTGG - Intergenic
1115502193 14:34060007-34060029 CCTGCCTAGCAGATACCGGCTGG + Intronic
1117756480 14:58979507-58979529 CCGCCCTGCCAGCTACTGTCGGG + Intergenic
1118617066 14:67581155-67581177 ACTGCCTGGCAGTCACTAGCTGG + Intronic
1118868409 14:69721219-69721241 GCTGCCTGGCTGTTGCTGGCAGG - Intergenic
1118913330 14:70080127-70080149 CCTGGCTGCCAGTTATCGTCTGG + Intronic
1121325865 14:93019267-93019289 CCTGCCTGGGAGAAACTGTGGGG + Intronic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1122765226 14:104064524-104064546 CCTGCCAGGCACTGACTGGCAGG + Intergenic
1123037208 14:105476337-105476359 CCTGCCTGGGAGGCACTGTGAGG + Intronic
1123160985 14:106277710-106277732 CCTGCAGGGAAGTTCCTGTCTGG + Intergenic
1124094440 15:26636092-26636114 CCTGCATGGTAGTTCCTGTCTGG - Intronic
1124959812 15:34385833-34385855 CCTGCCTGCCGCTTCCTGTCTGG - Intronic
1124976439 15:34532054-34532076 CCTGCCTGCCGCTTCCTGTCTGG - Intronic
1125081190 15:35675555-35675577 CCTGCCTGCAACTTTCTGTCGGG - Intergenic
1125887363 15:43238728-43238750 CCTGCCTCGCAGATGCTCTCTGG + Intronic
1128701295 15:69806398-69806420 CCTCCCTGGCTGTTAGGGTCTGG + Intergenic
1131071523 15:89469485-89469507 TCTGCATGGCAGTTGCTGCCTGG + Intergenic
1131446525 15:92502510-92502532 GCTGCCTGCCAGTAACAGTCAGG - Intergenic
1131868932 15:96741789-96741811 CCTGCCTGGCCCTGACTGGCTGG + Intergenic
1132827726 16:1913461-1913483 CCTGGCTGGCAGGTGCTGCCCGG - Intronic
1134830941 16:17322299-17322321 ACTGCCTGGTAGGTACTGTGAGG - Intronic
1137942377 16:52701150-52701172 CCTGCATCGCAGTTACTGTTTGG - Intergenic
1141203280 16:81913717-81913739 GCTGCATGGCAGCTACTGTGGGG + Intronic
1142026840 16:87818954-87818976 CCAGCCTGACAGTTACTTCCTGG + Intergenic
1144649916 17:17000911-17000933 CCTGCATGGAGCTTACTGTCTGG - Intergenic
1146254884 17:31386126-31386148 CCTGCCTGGAAGTTAGTTTCAGG + Intergenic
1148736916 17:49870079-49870101 CCTGCCTGCCACCCACTGTCTGG - Intergenic
1151368885 17:73634930-73634952 CCTACCTGTCATTTACTGCCTGG - Intronic
1153609701 18:6871218-6871240 CCTGCCTGGCTGTACCTGTGTGG + Intronic
1153772950 18:8429786-8429808 CCTGCCTGACAGTGATTGTAAGG - Intergenic
1155279617 18:24226055-24226077 CCTGCCTGACAATTACTATAGGG - Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1160580963 18:79884422-79884444 CCGGCCTGGCAGGGACTGGCTGG + Intronic
1160610062 18:80077819-80077841 CCTGCCTGGCAGCCGATGTCGGG + Intronic
1161222151 19:3122774-3122796 CCTGCCTGCCCGCCACTGTCAGG + Exonic
1162450677 19:10752547-10752569 CCTGGCTGGGAGTTACTGGAGGG + Intronic
1162792330 19:13069543-13069565 CCTGCCTGGCAGGGACTGCCAGG + Intronic
1163175832 19:15563648-15563670 CCAGCCTGGCACCTTCTGTCAGG - Intergenic
1163182646 19:15615270-15615292 CCAGCCTGGCACCTTCTGTCAGG - Exonic
1163202769 19:15780307-15780329 CCAGCCTGGCACCTTCTGTCAGG + Intergenic
1163218572 19:15898014-15898036 CCAGCCTGGCACCTTCTGTCAGG + Exonic
1163438449 19:17309554-17309576 CGTGGCTGGAAGTTACTGTGAGG + Exonic
1165113991 19:33518112-33518134 CCAGCCTGGCGCTTACGGTCTGG - Intronic
1166283496 19:41810080-41810102 TCTGCCTGGCAGTGACTGGCAGG - Intronic
925380394 2:3421017-3421039 CCAGCCTTGCAGTCTCTGTCAGG + Intronic
925515936 2:4681845-4681867 CCTCCAGGGAAGTTACTGTCTGG - Intergenic
927400709 2:22707090-22707112 CATGGCTGGCATTTAGTGTCTGG + Intergenic
929555956 2:42925775-42925797 CCTCCCTGCCAGGTCCTGTCTGG + Intergenic
932344523 2:70986901-70986923 CCTCCCTGGCTGTTCCTTTCAGG - Exonic
933159569 2:79009139-79009161 CCTGATAGGCTGTTACTGTCAGG + Intergenic
933347372 2:81106067-81106089 ACTGCCTGGCACTTACTGCTTGG - Intergenic
934512192 2:94954326-94954348 CCTGCATAGAAGTTCCTGTCTGG + Intergenic
940019705 2:149144220-149144242 CCAGCCTGCCAGTTTCTGTATGG + Intronic
941695541 2:168547436-168547458 TCTGCCTTACAGTTACTGACAGG + Intronic
942709097 2:178812450-178812472 CCTGCCAGGCAGGAACTGTGTGG - Intronic
944833224 2:203553931-203553953 ACTGCATGGCTGTTACTCTCAGG - Intergenic
945908755 2:215622852-215622874 CCTACCTGGCCATTACTGTTTGG - Intergenic
1169938934 20:10916153-10916175 CCTGCCTGGAGTTTACTGACAGG + Intergenic
1170918854 20:20656457-20656479 CATGCCTGGCATTTGGTGTCTGG - Intronic
1173690255 20:44955274-44955296 CCTGCCTGGAAGAAACTGTAGGG - Intronic
1173777522 20:45723188-45723210 CCAGCCTGGAATTTACTCTCTGG - Intronic
1174312274 20:49666997-49667019 CCTGCCTCTCAGTTATTGTGAGG - Intronic
1175877025 20:62235221-62235243 CCTGGCTGGCAGCTGCTGGCTGG - Intronic
1175903552 20:62369199-62369221 CCTGCCTGCCAGTTGCTCCCGGG - Intergenic
1176022504 20:62969090-62969112 GAAGCCTGGCAGTTGCTGTCTGG + Exonic
1181496230 22:23288810-23288832 CCTGCCTGGCAGTGTCGGTGGGG + Intronic
1182431130 22:30299484-30299506 CGTGCTTGGCAGTACCTGTCAGG - Exonic
1184029096 22:41880750-41880772 CCTGCCTGGCAGTTTTGGGCCGG + Exonic
1184113416 22:42408665-42408687 CCTGCCTGGCAGCAAGTGCCAGG - Intronic
950540415 3:13609136-13609158 ACTGCCTGCCAGTCACTGTTGGG - Intronic
950635385 3:14310847-14310869 GCTGTCTGGCAGTCACAGTCAGG + Intergenic
952828623 3:37544907-37544929 TATTTCTGGCAGTTACTGTCTGG + Intronic
952925355 3:38315989-38316011 CCTGCCTTGCACTCACTGCCTGG + Intronic
956165229 3:66393276-66393298 CCTGCCCAGCAGTTCCAGTCAGG + Intronic
956866530 3:73374468-73374490 ACTGCCTTGCACCTACTGTCTGG + Intergenic
957137410 3:76307115-76307137 CCTTCCTGGCAGTTCCTGGAAGG + Intronic
960060693 3:113317440-113317462 CCTGCCTGCCAGTCACTGCCGGG + Intronic
960727309 3:120683426-120683448 CATGTCTGGCAGTTCCTGTGGGG - Intergenic
966838469 3:184068194-184068216 CCTGCCTTTCAGTTAATGTTTGG + Intergenic
968706653 4:2081465-2081487 CCTGCCTGGCAGTTACTGTCAGG - Intronic
969272353 4:6111371-6111393 CCTGGCTGGCAGCTCCTCTCTGG + Intronic
970832227 4:20354120-20354142 CCTGCCTGGTAGTTAATTTGAGG - Intronic
977394583 4:96454877-96454899 CCTGCCTGGCAGTCAATTACAGG + Intergenic
977675285 4:99740557-99740579 CCAGCCTCACAGTTCCTGTCCGG - Intergenic
983090078 4:163493095-163493117 TCTGCATGGCAGTTGCTGCCTGG + Intergenic
983405803 4:167327961-167327983 CTGGCCTGACACTTACTGTCAGG + Intergenic
987592939 5:19955781-19955803 TATGCCTGGCAGTTACTCTTTGG - Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991646189 5:68802708-68802730 CCTGTCTGGCTGTGACTGGCAGG - Intergenic
995501366 5:112810600-112810622 GCTGCCTGGCACTTCATGTCAGG + Intronic
996673390 5:126146696-126146718 CGTGTCTGCCATTTACTGTCAGG - Intergenic
997999291 5:138611164-138611186 CCTGCCTGAGTGTTACTGTGTGG + Intronic
999134718 5:149310995-149311017 CCTGCCAGGCAGTGAGTGTGTGG + Intronic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1001669759 5:173463929-173463951 GCTGCCTTGCAGTGAGTGTCCGG + Intergenic
1003351144 6:5318850-5318872 TCTGCATGGCAGTTGCTGACTGG - Intronic
1004878731 6:19984093-19984115 GTTGCCTGGCAGTTACTCTGTGG - Intergenic
1006524055 6:34588913-34588935 TCTGCCTGCCTGTTTCTGTCTGG - Exonic
1006779863 6:36625029-36625051 CCTGCCTGGAGGGAACTGTCAGG + Intergenic
1007451178 6:41941238-41941260 AGTGACTGGCAGTCACTGTCGGG + Intronic
1010169355 6:72957013-72957035 CCAGCCTGGCTGCTAGTGTCTGG - Intronic
1011002224 6:82603967-82603989 GCTGCCTGGCAGATACTGTATGG - Intergenic
1013861329 6:114638682-114638704 CCTGACTGAGAGTCACTGTCTGG + Intergenic
1014972681 6:127836978-127837000 CTTTCCTGGAAGTGACTGTCTGG - Intronic
1015760511 6:136654838-136654860 CCTGCCTAGCAGTTCCTATTTGG + Intronic
1018875593 6:167819733-167819755 GCTGCATGGCAGTTCCTGGCAGG + Intergenic
1019590017 7:1826260-1826282 CGGGCCAGGCAGTGACTGTCAGG - Intronic
1020100414 7:5391193-5391215 CCTTCCTGGCAGCTCCTGCCTGG - Intronic
1022573705 7:31477475-31477497 CCTGCCTGGCCTCTGCTGTCAGG + Intergenic
1023614586 7:42006778-42006800 CCTCCCTGGCAATTCCTGTTAGG - Intronic
1025005959 7:55355110-55355132 CCACCCTGGCACATACTGTCAGG + Intergenic
1027813274 7:82933162-82933184 CCTGGCTGACAGTTCCTATCAGG + Intronic
1030358685 7:108570725-108570747 CCTGCCTGCTAATTACTCTCAGG + Intronic
1035111800 7:156488834-156488856 CCTCCCTGCCATTTACTATCAGG + Intergenic
1035218722 7:157391512-157391534 CCTGCTTGGCAGGGACTGGCAGG - Intronic
1038726230 8:30084651-30084673 AGTGCCTGGCAGGTACTGTTAGG - Intergenic
1039887730 8:41664789-41664811 CCTGCCAGGCGGTTACCTTCAGG + Intronic
1045335414 8:101198605-101198627 CCTGACTGGCAGTTAGAGCCAGG + Intronic
1046149108 8:110200476-110200498 CTTCCATGGCAGTTACTGTCTGG + Intergenic
1049047695 8:140165735-140165757 CCTGCCTTGCAGATAATCTCAGG - Intronic
1053480489 9:38413104-38413126 CCTGCCTCACAGTTACTGGAGGG + Intronic
1053656629 9:40223101-40223123 CCTGCACGGCAGTTGCTGCCGGG - Intergenic
1054357054 9:64071548-64071570 CCTGCATGGCGGTTGCTGCCCGG - Intergenic
1054368747 9:64369376-64369398 CCTGCACGGCAGTTGCTGCCGGG - Exonic
1054527971 9:66153131-66153153 CCTGCACGGCAGTTGCTGCCGGG + Intronic
1058665133 9:107306630-107306652 CCTACCTGTCAGTTGCTGTTGGG - Exonic
1059314118 9:113409995-113410017 CCTGGCTGGGAGTTGCTGGCTGG - Intronic
1061424055 9:130488360-130488382 CCTGCCCTGCAGCTGCTGTCTGG - Intronic
1061613886 9:131766603-131766625 ATTGCCTGGCAGTTCCTGCCCGG - Intergenic
1061938936 9:133873844-133873866 CCTGCCTGGAAGTTGCTGGGTGG - Intronic
1062249645 9:135587753-135587775 CCGGCCGGGCAGTTCCTGGCAGG - Intergenic
1062474648 9:136720993-136721015 CCTGCATGGCAGCTTCTGGCTGG - Intronic
1186123437 X:6386940-6386962 CCTGCATGAGAGTAACTGTCAGG + Intergenic
1188039016 X:25350537-25350559 CCTGCCTGGCTGTTTCTGCAGGG - Intergenic
1188223609 X:27570510-27570532 CCTCCCATGCAGTTTCTGTCTGG + Intergenic
1188425103 X:30037145-30037167 CATCCCTGGCAGTGACTGTGTGG - Intergenic
1194340948 X:92704876-92704898 CCTGCCTGTCACTTACTAGCTGG + Intergenic
1194491198 X:94551883-94551905 TCTGCGTGGCAGTTGCTGTGTGG + Intergenic
1197782632 X:130172556-130172578 CCTGCCTGACAGGTCCTGCCAGG + Intronic
1200649302 Y:5821595-5821617 CCTGCCTGTCACTTACTAGCTGG + Intergenic