ID: 968709430

View in Genome Browser
Species Human (GRCh38)
Location 4:2102251-2102273
Sequence GTGGATCCTGCACTCTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968709430_968709441 13 Left 968709430 4:2102251-2102273 CCCCAACAGAGTGCAGGATCCAC 0: 1
1: 0
2: 1
3: 11
4: 98
Right 968709441 4:2102287-2102309 CCACAACCCAATTTACCACCTGG 0: 1
1: 2
2: 3
3: 11
4: 84
968709430_968709442 14 Left 968709430 4:2102251-2102273 CCCCAACAGAGTGCAGGATCCAC 0: 1
1: 0
2: 1
3: 11
4: 98
Right 968709442 4:2102288-2102310 CACAACCCAATTTACCACCTGGG 0: 1
1: 1
2: 4
3: 16
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968709430 Original CRISPR GTGGATCCTGCACTCTGTTG GGG (reversed) Intronic
905284169 1:36868443-36868465 GTGGCTCCTGAGCTCTGCTGTGG + Intronic
908097671 1:60757280-60757302 TTGTATCCTGCACAGTGTTGTGG - Intergenic
914266206 1:146040374-146040396 GTGGACCCAGCACTCTGGAGTGG - Intergenic
915545935 1:156597822-156597844 GTGGATCCTGCCATCTGTTAAGG - Intronic
919884171 1:201920701-201920723 CTGGGTCCTGCACTGTGTAGAGG - Intronic
922377085 1:224979722-224979744 GTGGCTCCTTCCTTCTGTTGAGG + Intronic
923064534 1:230505732-230505754 GTGGATCCTGCACTATCTTGCGG - Intergenic
1067765538 10:49083069-49083091 GGGGTTCCTGGACTCTGCTGAGG - Intronic
1071344386 10:84678483-84678505 GAGGATCATGCAATTTGTTGAGG + Intergenic
1072752157 10:97988977-97988999 GAGCATCATGCAATCTGTTGAGG + Intronic
1074768995 10:116721366-116721388 CTGGATCCTGTGCTCTGTGGAGG - Intronic
1076015441 10:127024011-127024033 GTGGACCCTGCAGGCTGCTGTGG - Intronic
1077331689 11:1986775-1986797 GTGGATCCTGCACTCCCATGCGG - Intergenic
1077528485 11:3083539-3083561 GTGGAGCCTGGACCCTCTTGGGG - Intergenic
1078147946 11:8734980-8735002 ATGGATCCTGAACGCTGTCGGGG + Intronic
1078847306 11:15129914-15129936 GTGGAACCAGCCCTGTGTTGGGG + Intronic
1080101683 11:28466873-28466895 GTAGAGCCTTCAGTCTGTTGGGG + Intergenic
1080262637 11:30366095-30366117 GTGGATCTTACATTCTGTGGAGG + Intergenic
1081430360 11:42969938-42969960 GGGGATCCTGCACTGTGTCAAGG + Intergenic
1081846434 11:46243735-46243757 GTGGATCCTGGACAGTGCTGCGG - Intergenic
1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG + Intergenic
1088349647 11:108871354-108871376 GGGCATCCTGCCCTCTGCTGGGG + Intronic
1202814670 11_KI270721v1_random:41951-41973 GTGGATCCTGCACTCCCATGCGG - Intergenic
1092255770 12:6926158-6926180 GAGGAGCCTGCAGTCTGTGGTGG + Intronic
1093866344 12:24231549-24231571 GTGTATCTTTCACTTTGTTGTGG - Intergenic
1094336629 12:29364269-29364291 CTGGATTCTCCATTCTGTTGAGG - Intronic
1100282364 12:93130020-93130042 GTGTATCATGCCCTCTGTGGTGG - Intergenic
1101538199 12:105639989-105640011 GTGGCTTATGCACCCTGTTGTGG - Intergenic
1106977747 13:35241843-35241865 ATGTATGCTGCACTGTGTTGAGG - Intronic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1114532731 14:23405600-23405622 GTGGCTCCTGCACACTGCAGAGG - Intronic
1116801768 14:49451267-49451289 GTGGATCCTGTGCTCAGTGGGGG - Intergenic
1118321650 14:64757000-64757022 GTGGATCCTGCGCTCTGACTTGG + Intronic
1119323438 14:73744952-73744974 GTGGAGCCTGCTGTCTGCTGGGG - Intronic
1128945907 15:71820645-71820667 GTGGAGCCTGCATTCTAGTGGGG - Intergenic
1132484491 16:183384-183406 GTGGGCCCTCCACACTGTTGGGG + Intergenic
1134182782 16:12061229-12061251 AGGGAGCCTGCAGTCTGTTGGGG - Intronic
1138472528 16:57249471-57249493 CTGCATCCTGCACTGGGTTGTGG + Intronic
1145944060 17:28759751-28759773 GGGGAACCTTCACACTGTTGGGG + Exonic
1155407386 18:25503756-25503778 GTGGAGGCTGGACTCTGTTGCGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157048514 18:44132339-44132361 GTGCTTCATGCACTCTGTGGGGG + Intergenic
1159256225 18:65950103-65950125 GTGAATCTTGAACTCTGCTGTGG + Intergenic
1164968556 19:32509828-32509850 GTAGAGCCTCCACTCTATTGTGG - Intergenic
926373002 2:12199140-12199162 GTGGATGATGCACTCTGTGCAGG + Intergenic
930878291 2:56244532-56244554 GAGGATCCTGCAGTCTCTTAGGG - Intronic
936151330 2:110023902-110023924 GATGAGCCTGCACTCTGATGGGG + Intergenic
936193345 2:110347467-110347489 GATGAGCCTGCACTCTGATGGGG - Intergenic
936852052 2:116912092-116912114 GTGGATCCTGCATTAAGATGAGG + Intergenic
937482018 2:122271635-122271657 GTGGAGTCTGCAATCTGTTTTGG + Intergenic
940497859 2:154456866-154456888 GTTGATCCTGCGCTGTGCTGTGG - Intergenic
942618575 2:177822316-177822338 GTTGATCCAGCACTGTTTTGAGG + Intronic
942944506 2:181657721-181657743 CTGGATCTTGCACTCCCTTGAGG + Intronic
943356467 2:186862162-186862184 GAAGATCCTACACTCTGTGGGGG + Intergenic
1170780821 20:19423863-19423885 TCGTATCATGCACTCTGTTGTGG - Intronic
1170839841 20:19915591-19915613 TTGGAACCTGCGCTCTGATGCGG - Intronic
1174733818 20:52944800-52944822 GTGGATTTTCGACTCTGTTGGGG - Intergenic
1176366174 21:6034191-6034213 CTGGATCCTGCACTCTGTCCTGG - Intergenic
1178215698 21:30595255-30595277 ATGGATGCTGCAATCTTTTGTGG + Intergenic
1179459117 21:41521675-41521697 GAGGACAGTGCACTCTGTTGTGG - Intronic
1179757343 21:43504354-43504376 CTGGATCCTGCACTCTGTCCTGG + Intergenic
1184382520 22:44154477-44154499 GTGGTTTATGCAGTCTGTTGGGG + Intronic
956885092 3:73551213-73551235 GTGGATACTGCAGTCTGTAGGGG + Intronic
965499810 3:169443897-169443919 CTGGCTCCTCCACTCTCTTGAGG + Intronic
967309110 3:188089343-188089365 GTGAATCCTTCAGTCTGATGAGG - Intergenic
968709430 4:2102251-2102273 GTGGATCCTGCACTCTGTTGGGG - Intronic
969632125 4:8345031-8345053 CTGGATCCTTCTCTCTGCTGTGG - Intergenic
972381336 4:38523052-38523074 GTGGATGTTGAACTCTGGTGAGG - Intergenic
972381394 4:38523443-38523465 GTGGATGCTGCATTTTGTTTTGG + Intergenic
975197630 4:71544001-71544023 GTGCATCATGCACTCTGCTAAGG + Intronic
975853442 4:78597531-78597553 GTGTATCCTGGACCATGTTGGGG - Intronic
977184312 4:93917451-93917473 TTGGCTCCAGCACTCCGTTGAGG - Intergenic
984259600 4:177428484-177428506 GTGCATCCTGCACTGTCCTGGGG + Intergenic
989082242 5:37635298-37635320 GAGGATCCTGCACTGTGGTGTGG + Intronic
993383316 5:87233079-87233101 GGGCATCATGCAGTCTGTTGAGG - Intergenic
994142131 5:96353568-96353590 GTGCATCATCCAGTCTGTTGAGG + Intergenic
994549184 5:101208889-101208911 GTGCATTGTGCAATCTGTTGGGG - Intergenic
995737275 5:115314806-115314828 GTGGATCCTTCAATGTGTTTGGG + Intergenic
1001971431 5:175957786-175957808 GTGGATACTGCAGTCTGTTTGGG + Intronic
1002246011 5:177885991-177886013 GTGGATACTGCAGTCTGTTTGGG - Intergenic
1002371365 5:178757612-178757634 GGGCATCCTCCATTCTGTTGAGG + Intergenic
1003849597 6:10208234-10208256 GTGGATTTTCAACTCTGTTGGGG - Intronic
1009923001 6:70086212-70086234 GTGAATGCTGAATTCTGTTGTGG - Intronic
1015332992 6:132003320-132003342 GGGGATCATGCAATCTGTTGAGG + Intergenic
1015707291 6:136102002-136102024 GTTGTTCCTGGTCTCTGTTGTGG + Intronic
1018635714 6:165857525-165857547 GTGGAAGCTGCCCCCTGTTGAGG + Intronic
1021617410 7:22517296-22517318 GAGGATCCTGCATCCTCTTGAGG - Intronic
1022308348 7:29171967-29171989 CTGCATTGTGCACTCTGTTGAGG - Intronic
1022926998 7:35066710-35066732 GAGGATCCTGCATCCTCTTGAGG - Intergenic
1030496858 7:110311393-110311415 GTGGACCGTGCCCTTTGTTGTGG - Intergenic
1031751543 7:125581083-125581105 GAGGATCATCCAATCTGTTGAGG + Intergenic
1033574990 7:142672530-142672552 GAGGATGATGAACTCTGTTGGGG - Intergenic
1034035146 7:147811888-147811910 GTGGGTCCTGCATTCTAATGGGG + Intronic
1034888515 7:154818377-154818399 GTTGATCCAGCACTCTGAAGGGG - Intronic
1037842588 8:22255906-22255928 GAGGAGCCTGCACTCTAGTGAGG + Intergenic
1039332969 8:36559464-36559486 GTGGACCCTGCACTCCGCAGGGG - Intergenic
1041713976 8:60916922-60916944 GTGGAGCCTGCACTGGGGTGGGG + Intergenic
1042106583 8:65333771-65333793 GTGAATAATGCACTCTATTGGGG - Intergenic
1042648127 8:71009902-71009924 GTAGATTTTGCACTGTGTTGAGG + Intergenic
1045329643 8:101143960-101143982 GTGGACTCTGTACTCTGATGAGG + Intergenic
1045334181 8:101183640-101183662 GTAGATCCTGCACCCTGTGCTGG + Intronic
1048011378 8:130459211-130459233 GTGGAGCCTACATTCTGGTGGGG + Intergenic
1049113274 8:140663469-140663491 GCAGATCCTGGACTCTGTAGTGG + Intronic
1052354032 9:27486024-27486046 GTGGAGCTTACAGTCTGTTGGGG + Intronic
1186096480 X:6108018-6108040 GAGGAACCAGCACTGTGTTGTGG - Intronic
1187310916 X:18141524-18141546 GAGCATCATGCAATCTGTTGAGG - Intergenic
1195263790 X:103160642-103160664 GTTTTTCCTGTACTCTGTTGGGG + Intergenic
1197795044 X:130289568-130289590 ATGGAACTTGCATTCTGTTGGGG - Intergenic
1197867507 X:131034871-131034893 TAGGGCCCTGCACTCTGTTGAGG - Intergenic
1199602922 X:149553585-149553607 GTGGATCCTGAACTCCTATGAGG + Intergenic
1199647467 X:149925890-149925912 GTGGATCCTGAACTCCTATGAGG - Intergenic