ID: 968710041

View in Genome Browser
Species Human (GRCh38)
Location 4:2107905-2107927
Sequence TCTTGCCATAAGCCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968710034_968710041 27 Left 968710034 4:2107855-2107877 CCATAACAGCCACATATTGCCAA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG 0: 1
1: 0
2: 5
3: 31
4: 275
968710037_968710041 8 Left 968710037 4:2107874-2107896 CCAATGATGGACACATCAACCAC 0: 1
1: 0
2: 1
3: 8
4: 97
Right 968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG 0: 1
1: 0
2: 5
3: 31
4: 275
968710036_968710041 18 Left 968710036 4:2107864-2107886 CCACATATTGCCAATGATGGACA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG 0: 1
1: 0
2: 5
3: 31
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968710041 Original CRISPR TCTTGCCATAAGCCAGGCAC TGG Intronic
900000746 1:13611-13633 TGTTGCCAGGACCCAGGCACAGG + Intergenic
900020462 1:184130-184152 TGTTGCCAGGACCCAGGCACAGG + Intergenic
900905888 1:5557227-5557249 ACTTGCCATTGGCCAGGCATTGG + Intergenic
901157110 1:7148464-7148486 TCTTTCCAAAAGCCCAGCACAGG - Intronic
901600584 1:10420550-10420572 ACTTGCTCTAAGCCAGGCCCAGG + Intergenic
901906982 1:12421223-12421245 TCTTGCCAAGACCCAGGCAGGGG - Intronic
902209146 1:14892323-14892345 TCTTCCCATAATGAAGGCACAGG - Intronic
902408689 1:16200356-16200378 GCCTGCCATAGGCCAGGCCCAGG - Intronic
902658956 1:17888054-17888076 TCTTGGCATAAGCCCGGGAATGG + Intergenic
902718136 1:18286763-18286785 CCTTACCATGTGCCAGGCACTGG - Intronic
902858497 1:19227083-19227105 ACTTACCATATGCTAGGCACTGG + Intronic
903419224 1:23206550-23206572 TCCTGCCATACCCCAGGCTCCGG + Intergenic
905341100 1:37278148-37278170 GCTTACTATATGCCAGGCACTGG + Intergenic
905343956 1:37298822-37298844 GCTTTCAATAAGCCAAGCACAGG + Intergenic
907078198 1:51596818-51596840 TCCTCCTATATGCCAGGCACTGG + Intronic
907476075 1:54706473-54706495 TCTTGGCATACTCCAGGCTCTGG - Exonic
907789665 1:57649762-57649784 TCCTCCCATACACCAGGCACTGG + Intronic
907829046 1:58046787-58046809 TCCTGCCATGTGCCAGCCACTGG + Intronic
907964754 1:59318353-59318375 TCCTGCTGTATGCCAGGCACTGG + Intronic
908108880 1:60875051-60875073 ACTTGCCAAAGGCTAGGCACTGG - Intronic
908756736 1:67475672-67475694 TCTTCCTATGTGCCAGGCACTGG + Intergenic
909740831 1:79027720-79027742 GTTTGCTATATGCCAGGCACTGG - Intergenic
909924652 1:81425506-81425528 ACTTGCCATGAGCCAGGCATAGG - Intronic
910213202 1:84815045-84815067 ACTTACTATAAGCGAGGCACTGG + Intronic
912434924 1:109655020-109655042 TCCTACCATATTCCAGGCACTGG - Intergenic
912478590 1:109959988-109960010 TCATGTGATAAGCCAGGCCCAGG - Intergenic
914785943 1:150830966-150830988 ACCTGCCATATGCCAGGCACTGG + Intronic
915729401 1:158042583-158042605 TGTTTACAGAAGCCAGGCACTGG + Intronic
917013369 1:170500823-170500845 TCTTGCTGTGTGCCAGGCACTGG - Intergenic
917039475 1:170788491-170788513 AAGTGCAATAAGCCAGGCACAGG + Intergenic
917618649 1:176772075-176772097 AATTGGCACAAGCCAGGCACTGG - Intronic
917624033 1:176827803-176827825 TTTTACTATAAGCCAGGCATAGG - Intronic
917944735 1:179957540-179957562 TGTTACCATATGCTAGGCACTGG - Intronic
920501068 1:206485800-206485822 TCTTGGCCTATGCCAGGCAGGGG + Intronic
920757994 1:208753582-208753604 TCTTGCAATAATCCAGGTAAGGG + Intergenic
921405287 1:214772373-214772395 TCTTGAAATGAGCAAGGCACTGG - Intergenic
922212824 1:223498582-223498604 ACCTTCCATATGCCAGGCACTGG - Intergenic
922292799 1:224222613-224222635 CCTTGCCCTTGGCCAGGCACAGG + Intergenic
922580040 1:226690276-226690298 ACATACCATCAGCCAGGCACCGG + Intronic
923509707 1:234639745-234639767 GCTTGCTATCAGCCAGGTACAGG - Intergenic
924137094 1:240979888-240979910 TCTTACCATGGGCCAGGCACTGG - Intronic
1063491561 10:6468990-6469012 TCTTGCTATATGCCAGGCACAGG - Intronic
1064684715 10:17848392-17848414 TATTGCCTTGAGCCTGGCACAGG - Intronic
1065172639 10:23047345-23047367 TCTTGCCCTCAGCCTGTCACTGG + Intergenic
1065961315 10:30736435-30736457 TCTTGCCATGTGCCAGACGCCGG - Intergenic
1069305405 10:66962933-66962955 TCTTGCCTTATGCCAGGCACTGG - Intronic
1069380526 10:67839666-67839688 TCATGCCATAATCCCAGCACTGG + Intergenic
1070680960 10:78448670-78448692 ACTTGCCATCAGCCTGGCCCAGG - Intergenic
1070681337 10:78451434-78451456 GCTTGCCCTGTGCCAGGCACAGG - Intergenic
1071706336 10:88003497-88003519 ACTTACCACAAGCCAGGCACAGG + Intergenic
1072727309 10:97822430-97822452 TCTGGTCAGAAGCCAGGCCCAGG + Intergenic
1072902869 10:99425008-99425030 TCTCACCATGAGCCAGGCACTGG + Intronic
1073127994 10:101164114-101164136 TCTGGCCAGAAGCCAGAAACAGG + Intergenic
1073740069 10:106396491-106396513 CCATGCCATAAGCCAGAAACAGG - Intergenic
1074123707 10:110511945-110511967 GTCTGCCATATGCCAGGCACTGG - Intergenic
1074723380 10:116283468-116283490 TTTTGGCACATGCCAGGCACAGG + Intergenic
1074966746 10:118497455-118497477 TCCTGGCACAAGCCCGGCACTGG - Intergenic
1075170331 10:120107420-120107442 TCTTTCCATAAGAAAGGCAAAGG - Intergenic
1075401137 10:122162669-122162691 GCCTGCCATAGGCCAGGGACAGG + Intronic
1075404962 10:122188648-122188670 CCTGGCCATAACCCAGGCATGGG + Intronic
1075498364 10:122948402-122948424 TCTTGCAGTAAACAAGGCACTGG - Intronic
1077942508 11:6858430-6858452 ACTTACTATATGCCAGGCACTGG - Intergenic
1078093947 11:8284995-8285017 CCTGGCATTAAGCCAGGCACTGG - Intergenic
1078845867 11:15118001-15118023 CCTTGCCCTAAGCCTGGCCCTGG + Intronic
1079007761 11:16804113-16804135 TCTTGCCAAAAGTCATGCAGGGG + Intronic
1080733624 11:34986913-34986935 TCTTACGCTATGCCAGGCACTGG + Intronic
1080835594 11:35937553-35937575 TGTTGAAATAACCCAGGCACAGG + Intergenic
1081590280 11:44417966-44417988 GCTTGGGATGAGCCAGGCACAGG + Intergenic
1081766933 11:45617810-45617832 GCCTGCCATGTGCCAGGCACAGG - Intergenic
1083012742 11:59419349-59419371 TATTACCATATGCCAGGCACTGG + Intergenic
1084764699 11:71300748-71300770 TCTCCCCATCAGCCAGGCAGTGG + Intergenic
1085345274 11:75764562-75764584 ACTTGCCCTAAGAGAGGCACAGG - Intronic
1085740594 11:79075129-79075151 GTTTGCCATAGGCCAGGCACCGG + Intronic
1086336581 11:85807088-85807110 ACTTGCCCTAAGCAAGGCAGAGG - Intronic
1086867061 11:91992377-91992399 GCTTGCTATATGCCAGGCACTGG - Intergenic
1087157986 11:94923241-94923263 TCTCTCCATGCGCCAGGCACTGG + Intergenic
1090251585 11:125255509-125255531 GCTTGCCCCATGCCAGGCACTGG + Intronic
1090652544 11:128820182-128820204 TCTTTCTAGAAGCCAGGCACTGG - Intergenic
1091373844 12:13738-13760 TGTTGCCAGGACCCAGGCACAGG + Intergenic
1091611510 12:2014454-2014476 TCTTACCATGAGACAGGCACCGG + Intronic
1091870634 12:3887869-3887891 CCTTGCCATAAGACATGAACTGG - Intergenic
1094301495 12:28969672-28969694 TCATGCCATGTACCAGGCACTGG + Intergenic
1094723282 12:33087152-33087174 GCCTGCCATGTGCCAGGCACTGG + Intergenic
1095202071 12:39395993-39396015 TCTTGAAACAAACCAGGCACAGG + Intronic
1096217491 12:49806086-49806108 TCCTGCTATGTGCCAGGCACTGG + Intronic
1096794180 12:54064101-54064123 GCTTGCTATATACCAGGCACTGG + Intergenic
1097375174 12:58834964-58834986 TCTTGAAATAAGCCAGTGACTGG - Intergenic
1097900709 12:64871266-64871288 ACTTGCCATCAGCAAGGCACAGG - Intronic
1098231114 12:68372776-68372798 GTGTGCCATGAGCCAGGCACTGG + Intergenic
1099122539 12:78709657-78709679 TATTGCAATAAGCCAGACAGGGG + Intergenic
1099341573 12:81443148-81443170 ACTTGCCATATGCTAAGCACTGG + Intronic
1100759861 12:97795492-97795514 TCCTACCATGAACCAGGCACTGG - Intergenic
1101707590 12:107235003-107235025 CCTTACCATAAGCCAGGTACTGG - Intergenic
1102195808 12:111024373-111024395 TTTTGCCAAAGGCCAGGCTCCGG + Intergenic
1102785828 12:115603969-115603991 GCTTACCATAAGCCAGGTAGTGG - Intergenic
1102873524 12:116432300-116432322 TGTTGCTAAAAGCAAGGCACCGG - Intergenic
1105824576 13:24110624-24110646 ACTTGCCATGGGCCAGACACTGG + Intronic
1106574061 13:30957790-30957812 ACCTGTGATAAGCCAGGCACTGG - Intronic
1110634845 13:77754840-77754862 TCTGGCAATACGTCAGGCACTGG - Intronic
1111425525 13:88075551-88075573 TATTGCCATAAACCAGGGACTGG + Intergenic
1112262005 13:97885588-97885610 TGCTGCCATGAGCCAGGCAGTGG - Intergenic
1114215588 14:20655527-20655549 ACTTGCCATAAGACAGGGAGTGG - Intergenic
1114216041 14:20658486-20658508 ACTTGCCATAAGACAGGAAGTGG - Intergenic
1114654243 14:24306517-24306539 TCTTGCCATTGGGCAGGCATTGG - Exonic
1117541548 14:56751568-56751590 TCTTGCCCTATGCCAGACACTGG + Intergenic
1118448017 14:65869373-65869395 CCTGCCCATAAGCCTGGCACTGG - Intergenic
1118732166 14:68676070-68676092 TCTTACTATGTGCCAGGCACTGG + Intronic
1118985985 14:70755157-70755179 GCTTGCCCTATGCCAGGTACTGG - Intronic
1120302458 14:82725408-82725430 TTTTGCCATAAGCCAGGGCTAGG + Intergenic
1121435595 14:93917175-93917197 CTTTGCCATGTGCCAGGCACTGG + Intergenic
1122102658 14:99425614-99425636 TCTCGCTCTAAGCAAGGCACTGG + Intronic
1123817552 15:23995260-23995282 TCTTGCCATTAGACAGACACAGG - Intergenic
1124215740 15:27806091-27806113 TGGTGCCATTAGCCAGGCACTGG - Intronic
1126070338 15:44860377-44860399 GCCTGCCATGTGCCAGGCACTGG - Intergenic
1126087697 15:45024740-45024762 GCCTGCCATGTGCCAGGCACTGG + Intronic
1126940888 15:53763888-53763910 TTATCCCATAAGTCAGGCACAGG - Intergenic
1128037043 15:64536309-64536331 TCATGCCATAGGCTGGGCACAGG - Intronic
1129076642 15:73002568-73002590 CCTTGCGTTAAGCCTGGCACAGG + Intergenic
1129121213 15:73397879-73397901 ACTTACCATGGGCCAGGCACTGG + Intergenic
1129437890 15:75556955-75556977 TCATGAAATAAGCCAGACACAGG - Intronic
1129697948 15:77751296-77751318 ACTTACCATGTGCCAGGCACAGG - Intronic
1129834219 15:78691950-78691972 TCTTGCCACATGCCAGACACAGG + Intronic
1130724934 15:86429288-86429310 TTTTGCCATAAGACTGGCCCTGG - Intronic
1131409950 15:92199313-92199335 TCTGGCCAGAAGCCAGAAACAGG + Intergenic
1131453803 15:92567498-92567520 TCTGGCCAGAAGCCAGAAACAGG - Intergenic
1131791660 15:95972184-95972206 TGTGGCCATGTGCCAGGCACTGG - Intergenic
1132452763 15:101977334-101977356 TGTTGCCAGGACCCAGGCACAGG - Intergenic
1132454134 16:13292-13314 TGTTGCCAGGACCCAGGCACAGG + Intergenic
1132904699 16:2276638-2276660 TCTCGCCATCAGGCAGGGACAGG - Exonic
1134204281 16:12224348-12224370 GCCTGCCATAGGCCAGGCCCCGG + Intronic
1134805186 16:17118215-17118237 ACATGCCATACACCAGGCACAGG - Intronic
1138276334 16:55737574-55737596 CATTGCCATAATCCAGGCAATGG + Intergenic
1138286688 16:55815710-55815732 CATTGCCATAATCCAGGCAAGGG - Intronic
1138698918 16:58842441-58842463 TCTTGGTCTAAGCCAGGCTCAGG - Intergenic
1141157355 16:81606622-81606644 ACTTGCCATGAGCCAGGCACTGG + Intronic
1141198335 16:81878294-81878316 TCTTTTAAGAAGCCAGGCACTGG + Intronic
1141232424 16:82181656-82181678 GCTGGCCATGTGCCAGGCACTGG + Intergenic
1143190814 17:5038901-5038923 TCTTGTTATATGCCAGGTACTGG + Intronic
1144747383 17:17625021-17625043 TCTTCACATATTCCAGGCACTGG + Intergenic
1146002074 17:29137010-29137032 ACTTACTATGAGCCAGGCACAGG + Intronic
1146118510 17:30166388-30166410 TCTTGCCATAAATCAGGGAAGGG - Intronic
1147546215 17:41403801-41403823 TCTTACTATGAGCCAGGCGCTGG - Intergenic
1148329594 17:46805804-46805826 TCTTTCCTTAATCCAGGCCCAGG - Intronic
1148490779 17:48023079-48023101 GTTTGCCATGAGCCAGGCACTGG - Intergenic
1148517699 17:48236893-48236915 TCTTACTATGTGCCAGGCACTGG + Intronic
1148902000 17:50885255-50885277 TTTTGCCCAAAGCCAGGCAAAGG + Intergenic
1149423842 17:56535845-56535867 TCTTGCTGTATGCCAGGCAAAGG + Intergenic
1150582473 17:66487281-66487303 ACATGACATAAGCCAGGCACAGG - Intronic
1150617210 17:66781578-66781600 TCTTGAAGTAAGCCAGTCACAGG + Intronic
1151013678 17:70530934-70530956 TCCTGCCAATAGCCAGGGACCGG + Intergenic
1151537164 17:74745467-74745489 TCTTGGAATAAGCCAGGCCTGGG - Exonic
1151897798 17:76991965-76991987 TCTTGCCCTTAGCCAGGAGCAGG + Intergenic
1153261212 18:3226224-3226246 TGCTGCAGTAAGCCAGGCACTGG + Intergenic
1153503010 18:5768063-5768085 TCCTGCCAGAAGCCAGAAACAGG - Intergenic
1153613662 18:6912963-6912985 TCTTTCCAAGTGCCAGGCACGGG + Exonic
1155240156 18:23857025-23857047 ACTTGCCAAGTGCCAGGCACTGG + Intronic
1155312324 18:24535937-24535959 TCTTGCAAAAAGCCAAGAACTGG - Intergenic
1155620074 18:27768341-27768363 GTTTGCTATGAGCCAGGCACTGG + Intergenic
1156191223 18:34723245-34723267 ACTTGCCATAAGCAAAGCATCGG + Intronic
1159793131 18:72808919-72808941 CCTTGCCAGGAGCCTGGCACGGG + Intronic
1159961577 18:74559365-74559387 TCTTGTCTGAAGCGAGGCACAGG - Exonic
1161424708 19:4196839-4196861 ACCTGCCATGGGCCAGGCACTGG + Intronic
1161596636 19:5154124-5154146 TCTTGCCGCACACCAGGCACAGG - Intergenic
1163289434 19:16369913-16369935 TCTATGCATGAGCCAGGCACGGG + Intronic
1166077293 19:40421125-40421147 TCTGGCCAGAAGCGAGGCTCTGG + Intergenic
1166884312 19:45950495-45950517 GCTTCCCATGTGCCAGGCACTGG - Intronic
1166967290 19:46536743-46536765 TCTTACAATATGCCAAGCACTGG - Intronic
925488350 2:4362622-4362644 ACATGAAATAAGCCAGGCACAGG - Intergenic
926635173 2:15170631-15170653 TCTTGCAAAGAGCCAGGCCCAGG - Intronic
926962024 2:18367562-18367584 TCTTGCAAGATGCCTGGCACAGG + Intergenic
927853209 2:26512819-26512841 ACCTGCCACATGCCAGGCACAGG + Intronic
930110773 2:47676751-47676773 TCTGGCCAGAAGCCAGAAACAGG - Intergenic
931894347 2:66712602-66712624 TCTTACCATCTGCCAGGCTCTGG - Intergenic
932215240 2:69962056-69962078 TCCTACCACATGCCAGGCACTGG + Exonic
933916378 2:86998224-86998246 CTGTGCCATAGGCCAGGCACTGG + Intronic
934006615 2:87771681-87771703 CTGTGCCATAGGCCAGGCACTGG - Intronic
935172567 2:100621795-100621817 TCTTTCCAGTAACCAGGCACAGG + Intergenic
936568976 2:113599806-113599828 TGTTGCCAGGACCCAGGCACAGG - Intergenic
938680929 2:133689384-133689406 TCTTCCCCTCAGCCAGGCAGGGG + Intergenic
939057780 2:137384219-137384241 TCTGGACACAAGCCAGTCACAGG + Intronic
941862613 2:170299506-170299528 ACTTGCTATAAGCCAGGCACTGG + Intronic
941939079 2:171014165-171014187 GCCTGCCATATGTCAGGCACTGG + Intronic
942540515 2:177010301-177010323 TCTTGCGATAAGTCGAGCACAGG - Intergenic
942997682 2:182284070-182284092 TCTTGCAATAGGCCAGGTAAGGG - Intronic
944064482 2:195604329-195604351 TCTTACCCTAAGCAAGGCACAGG + Intronic
944949165 2:204727602-204727624 TCCTGCCAGAAGCCAGAAACAGG + Intronic
945022953 2:205592459-205592481 GCCTACCATGAGCCAGGCACTGG + Intronic
945589213 2:211708703-211708725 TTTTACAATATGCCAGGCACTGG + Intronic
946601698 2:221365893-221365915 TGTTCCCTTAATCCAGGCACTGG - Intergenic
947671680 2:231940903-231940925 CTTTGCCATAAGCGGGGCACTGG + Intergenic
1169090521 20:2858816-2858838 GCCTGCCATAAGCCAAGCATTGG + Intronic
1170595871 20:17805351-17805373 TAGTGAAATAAGCCAGGCACAGG + Intergenic
1170730377 20:18969768-18969790 TCTAGCCATATTCCAGGAACAGG - Intergenic
1170799832 20:19581992-19582014 TCTTTCCAGGAGACAGGCACGGG - Intronic
1172768813 20:37365093-37365115 ACTTGCTAGGAGCCAGGCACAGG + Intronic
1173426118 20:42944909-42944931 TCTTGCTATGTACCAGGCACAGG - Intronic
1174401588 20:50278750-50278772 ACTTACCATCTGCCAGGCACTGG - Intergenic
1174586575 20:51613348-51613370 ACTTGCCCCATGCCAGGCACTGG + Intronic
1175282506 20:57813478-57813500 ACTTTCCATAAGCCAGGCACTGG - Intergenic
1175664356 20:60845544-60845566 TCATGACATAAGCCAAGGACAGG - Intergenic
1175838498 20:62011789-62011811 ACCTGCCATGAGCCAGGCAGTGG - Intronic
1176799599 21:13411876-13411898 TCATGGTATAAACCAGGCACTGG - Intergenic
1177714361 21:24820036-24820058 GCTTACTATATGCCAGGCACTGG + Intergenic
1177838188 21:26209129-26209151 TCCTGCCAGAAGCCAGAAACCGG + Intergenic
1180751318 22:18126446-18126468 TCTTGCCATAATCCAGGGAGAGG - Exonic
1182009656 22:26989869-26989891 GCTTGCCAGAAGCCAGGCTGTGG + Intergenic
1182497688 22:30721405-30721427 GCCTGCCACAGGCCAGGCACTGG - Intronic
1183161830 22:36119049-36119071 TCTTACCATAAGCCAGACTTTGG + Intergenic
1184236490 22:43186036-43186058 TCTGGCCAGCAGCCAGGCTCAGG + Intronic
949614929 3:5743061-5743083 GCTTGCTATATGCCAAGCACAGG - Intergenic
951680871 3:25293389-25293411 GCTTGTGATATGCCAGGCACTGG - Intronic
952263015 3:31758881-31758903 TCTGGCCAGAAGCCAGAAACAGG - Intronic
954013660 3:47665790-47665812 TCCTGCCATAACCCAGGTTCAGG + Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954396378 3:50295539-50295561 GCTGGCCACAACCCAGGCACAGG + Exonic
954893615 3:53956073-53956095 TCCTACCATGTGCCAGGCACTGG - Intergenic
955780302 3:62477516-62477538 TCCTCCCATATGCCAGGCACAGG - Intronic
956379537 3:68651163-68651185 ACTTACCACATGCCAGGCACTGG + Intergenic
958812529 3:98878321-98878343 TCTTGCCAAAAGTCTGTCACTGG + Intronic
958902841 3:99907908-99907930 TCCTTCCATGTGCCAGGCACTGG - Intronic
959022478 3:101203417-101203439 TCTTGCTGTATGCCAGGCACTGG - Intergenic
959273575 3:104246134-104246156 TGTTGCCAGAAGAAAGGCACAGG - Intergenic
959800116 3:110483630-110483652 TATTGACATAAGTCAGGCAAAGG - Intergenic
961417014 3:126766679-126766701 TCTTCCCACAAGCCAGGCTCTGG + Intronic
963283906 3:143413984-143414006 TCTAGCCCTGGGCCAGGCACTGG - Intronic
963365562 3:144330119-144330141 ACTTGAAATAAGCCAGGTACAGG + Intergenic
963762755 3:149300701-149300723 TCTGGCCAGAAGCCAGAAACAGG - Intergenic
965822234 3:172696088-172696110 TCTTGTTATATGCCAAGCACTGG + Intronic
968119804 3:196118028-196118050 TCTTGCCATGCGCCAGACCCTGG - Intergenic
968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG + Intronic
969585423 4:8088565-8088587 TGTTGCCATGTGCCAAGCACTGG - Intronic
970156862 4:13150626-13150648 TATTGCTATATTCCAGGCACTGG - Intergenic
972143100 4:35985882-35985904 ACCTGAAATAAGCCAGGCACAGG + Intronic
973740618 4:53916215-53916237 TCCTGCCATGGGCCAGGCCCTGG - Intronic
974427727 4:61761501-61761523 TATTGCCAGAGGCCAGGCATGGG + Intronic
976875249 4:89846803-89846825 TCTGGACACAAGGCAGGCACTGG - Intergenic
978068506 4:104436603-104436625 TCTTGCCATACACCAAACACTGG + Intergenic
978327212 4:107573104-107573126 TCTTAATATAAGCCAGACACAGG + Intergenic
978449605 4:108817398-108817420 TTTTGCCAACAGCCAGGCATGGG + Exonic
982002282 4:151031919-151031941 GCTTGCCATTGGCCAGGCTCTGG + Intergenic
983347508 4:166546074-166546096 TCCTGCCACAAGCCTGGCAAAGG - Intergenic
986329537 5:6707361-6707383 TGTTGGCCAAAGCCAGGCACAGG - Intergenic
987108793 5:14665305-14665327 TCTTTCCTTCAGCCTGGCACAGG + Intronic
987419821 5:17706103-17706125 GCCTACCATATGCCAGGCACTGG - Intergenic
990850640 5:60199923-60199945 TCTTGCCATAAGCAAAGAATAGG - Intronic
994812038 5:104532272-104532294 TCTTGCCATCAGCCAAGAATGGG + Intergenic
995878176 5:116814033-116814055 TCTTGCTAAAAGCCAGTAACAGG - Intergenic
996452246 5:123638585-123638607 AAGTGACATAAGCCAGGCACAGG + Intergenic
996602256 5:125277949-125277971 TCTTGCCAAGTGCCAGGCATTGG - Intergenic
998310077 5:141121479-141121501 TCTTTACATAATCCAGCCACAGG - Intronic
998409714 5:141900336-141900358 GCTTACTATATGCCAGGCACTGG - Intergenic
998410224 5:141904489-141904511 ACTTACCATATGCCAAGCACTGG - Intergenic
999094007 5:148962155-148962177 TCATGCCAGACACCAGGCACTGG + Intronic
999389304 5:151178665-151178687 ACTTGCCACATGCCAGACACTGG + Intergenic
1000396121 5:160776410-160776432 GCTTACTATATGCCAGGCACTGG + Intronic
1002297379 5:178239142-178239164 TTATGCCAGCAGCCAGGCACAGG + Exonic
1004606413 6:17199310-17199332 TATTGAAATAATCCAGGCACAGG - Intergenic
1006045603 6:31294005-31294027 TCTTGCTATATTTCAGGCACTGG - Intronic
1006517178 6:34551547-34551569 TCTTGCCATCAGCCTGGCTTTGG + Intronic
1007960261 6:45952422-45952444 TCTTGCTATGAGTCAGGTACAGG + Intronic
1008048918 6:46880226-46880248 TCCTGCCACATGCCAGGGACAGG + Intronic
1008886003 6:56432174-56432196 TCTTCCCACAAGCCAGGCTCTGG + Intergenic
1011170550 6:84499939-84499961 GCATGCCATATGCTAGGCACTGG - Intergenic
1015416115 6:132950565-132950587 ACTTACTATATGCCAGGCACTGG + Intergenic
1016393085 6:143594402-143594424 TGCTGGCATAAGCCAGGCATTGG - Intronic
1016528966 6:145037292-145037314 TCTTCCCAAACACCAGGCACTGG - Intergenic
1016857631 6:148687013-148687035 TCATACCATGGGCCAGGCACTGG + Intergenic
1019344172 7:521452-521474 TCTTTCCAGAAGCCATGCAGTGG - Intergenic
1020918670 7:14233175-14233197 ACTTGCCTTAAGCTATGCACAGG + Intronic
1023987462 7:45105083-45105105 TCTAGCCAGAAGCCAGGCCTGGG + Intronic
1023987924 7:45108478-45108500 CCTTGCCATCAGCCAGACACTGG + Intronic
1024470790 7:49767297-49767319 TCTTCCCAGGAGCCAGACACTGG - Intergenic
1026382521 7:69813784-69813806 GCCTGCCATATGCCAAGCACAGG - Intronic
1030884449 7:114921710-114921732 GCTTGCCATAGGCCAGGCTGGGG + Intergenic
1032063096 7:128741234-128741256 TCTGGCAATCAGCCAGGAACAGG - Intronic
1032265623 7:130368161-130368183 CCTTGCAGTAAGCCAGGCACTGG - Intronic
1033062790 7:138124005-138124027 TCTTCCCACAAGCCAGGCTCTGG - Intergenic
1033761449 7:144440728-144440750 ATTTCCCATATGCCAGGCACTGG - Intergenic
1035214887 7:157358143-157358165 TCTTGCCCGATGCCTGGCACAGG + Intronic
1037810175 8:22082145-22082167 TCCAGCACTAAGCCAGGCACCGG + Exonic
1039484482 8:37899980-37900002 ACTCACCATGAGCCAGGCACTGG - Intergenic
1040382094 8:46882800-46882822 TCTACCCATAATCCAGGCCCAGG + Intergenic
1041369913 8:57148435-57148457 ATTTGCCATCAGCCAGGGACTGG - Intergenic
1041473532 8:58237364-58237386 ACTTGCCCTTGGCCAGGCACTGG - Intergenic
1043623355 8:82225527-82225549 TCTTAATATGAGCCAGGCACTGG + Intergenic
1046749402 8:117911146-117911168 ACTTGCCGTGTGCCAGGCACTGG - Intronic
1049883552 9:13724-13746 TGTTGCCAGGACCCAGGCACAGG + Intergenic
1052461939 9:28775995-28776017 GCTTGCCATGAGCCAGGGACTGG - Intergenic
1053255385 9:36612889-36612911 TCTTTCCATAAAGAAGGCACAGG - Intronic
1055797994 9:79997149-79997171 TCAGGCCCTAGGCCAGGCACTGG + Intergenic
1056317974 9:85409707-85409729 TCTTGCCACTCCCCAGGCACAGG - Intergenic
1056911220 9:90702635-90702657 TCCTGCCAGAAGCCAGAAACAGG + Intergenic
1059446994 9:114344361-114344383 GCTTTCCATCTGCCAGGCACTGG - Intronic
1059750138 9:117239779-117239801 TCATTCCATATGCCAGGCTCAGG + Intronic
1060088150 9:120720075-120720097 TCTAGCCAAAGGCCAGGCACAGG + Intergenic
1060196377 9:121626219-121626241 TCTTGCCTTGTGCCTGGCACTGG + Intronic
1061980920 9:134103128-134103150 TGTCTCCATCAGCCAGGCACAGG - Intergenic
1062139148 9:134945829-134945851 TCTTGCCCTGAGCCAGGCCCTGG + Intergenic
1186586984 X:10885703-10885725 TCTCACCACATGCCAGGCACTGG + Intergenic
1187300276 X:18042298-18042320 TATTGTCATCAGCCAGGCAGTGG - Intergenic
1189161880 X:38817573-38817595 ACTTACTATATGCCAGGCACTGG + Intergenic
1189204137 X:39223197-39223219 GCTTGCTATATGCCAGGTACTGG + Intergenic
1192046207 X:67676592-67676614 TTTTGCCATAAACCCTGCACAGG - Intronic
1192110822 X:68362252-68362274 TAGTGAAATAAGCCAGGCACAGG + Intronic
1193257718 X:79368777-79368799 TCTGGCCCTAAGTAAGGCACAGG - Intergenic
1196577479 X:117336592-117336614 AGTTGAAATAAGCCAGGCACAGG - Intergenic
1197119199 X:122870033-122870055 TTTTGCCCTGAGCCAGGCTCTGG - Intergenic
1197764021 X:130047777-130047799 TCTTACTATGTGCCAGGCACTGG + Intronic
1198324547 X:135555267-135555289 TGTTATAATAAGCCAGGCACTGG - Intronic
1198642065 X:138767200-138767222 TCTTGGCCTCAGCAAGGCACTGG + Intronic
1199187071 X:144927694-144927716 TCTTCCGATAAGCCAAGCAGAGG - Intergenic
1200402264 X:156026425-156026447 TGTTGCCAGGACCCAGGCACAGG - Intergenic