ID: 968711812

View in Genome Browser
Species Human (GRCh38)
Location 4:2125021-2125043
Sequence TCTTTCTAGGGTTATATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968711805_968711812 21 Left 968711805 4:2124977-2124999 CCTAAGCAATAAATGAGGTCTTC 0: 1
1: 0
2: 2
3: 9
4: 151
Right 968711812 4:2125021-2125043 TCTTTCTAGGGTTATATTTAGGG 0: 1
1: 0
2: 1
3: 16
4: 236
968711808_968711812 -4 Left 968711808 4:2125002-2125024 CCAGGTTGAAGATAGGATTTCTT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 968711812 4:2125021-2125043 TCTTTCTAGGGTTATATTTAGGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968711812 Original CRISPR TCTTTCTAGGGTTATATTTA GGG Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
905529161 1:38662776-38662798 TCTTTCCAAGGCTATATGTACGG + Intergenic
906527253 1:46501571-46501593 TCTTTCTTTGGTTATAAATAAGG + Intergenic
908343005 1:63202046-63202068 TCTTTGTTGGCTTCTATTTATGG + Intergenic
908485241 1:64585446-64585468 TTTTTCTAGGGGTACAGTTAAGG - Intronic
909892122 1:81020410-81020432 TCTTTCTATGATTTTGTTTATGG + Intergenic
909967649 1:81935963-81935985 TCTTTTTAATGTTATATTTTAGG + Intronic
910321001 1:85944486-85944508 TCTTTCCAGAATTATATTTTCGG + Intronic
911078697 1:93907295-93907317 GGTTTCTAGTGTTTTATTTAGGG - Intronic
911220162 1:95236894-95236916 TCTTTCTATGCTTACATTTTTGG - Intronic
911463537 1:98221704-98221726 TCTTAGTGGGGTTATGTTTAGGG + Intergenic
911652074 1:100400629-100400651 TCTTTGTAGGCTTGTATTTTTGG + Intronic
914445491 1:147747209-147747231 TCTTCCTAGCGTTTTATGTATGG + Intergenic
914793232 1:150898166-150898188 TCTTTCTAGGATGATGTTCAGGG + Intergenic
917563794 1:176189120-176189142 TCTTTCTAGGGCTGCCTTTAAGG - Intronic
920335001 1:205239183-205239205 TCTTTCTAGCGTTCTATTCCAGG - Intronic
924321075 1:242851047-242851069 GCTTTCTAGGGGAATCTTTAGGG + Intergenic
1063699478 10:8370698-8370720 TCTTTTTAATGTTATATTTCTGG + Intergenic
1064818118 10:19290422-19290444 TTTTTCTAGGGTTGTAATCAAGG + Intronic
1064865238 10:19871936-19871958 CCTTTATAGGGTTACACTTAAGG - Intronic
1066193024 10:33073156-33073178 AGTCTCTATGGTTATATTTAGGG + Intergenic
1068117385 10:52749979-52750001 TCCCTCTATGTTTATATTTATGG + Intergenic
1068619629 10:59166875-59166897 AATTTCTGTGGTTATATTTAAGG + Intergenic
1068736606 10:60420311-60420333 TCTTTATTGGGTCATGTTTAAGG + Intronic
1069055663 10:63842050-63842072 TCTTTTTAAAGTTAGATTTATGG - Intergenic
1069313691 10:67071211-67071233 TATTTCCAAGGTTCTATTTAGGG + Intronic
1070222383 10:74462351-74462373 TCTTTCTAAGAGTATATTTTAGG + Intronic
1072410558 10:95198216-95198238 TTTTTTTAGGGTGATATGTAGGG - Intronic
1074544494 10:114392084-114392106 TCTTTCTAGGATTCTGTCTATGG - Intronic
1080519888 11:33059607-33059629 TATTTCTAGGGTGCTTTTTATGG + Intronic
1087671221 11:101109249-101109271 TCTTTCTAGCTTTTAATTTAAGG - Intronic
1093145169 12:15556727-15556749 TCTTTGTAGGGTTTTGTTTATGG - Intronic
1093516644 12:19994762-19994784 TCTTTCTTTGGTCATATTTTTGG - Intergenic
1093665109 12:21803297-21803319 TGTTTATAAGATTATATTTATGG - Intronic
1093674440 12:21920442-21920464 TATTTGTAGGTATATATTTATGG + Intronic
1094013889 12:25840952-25840974 TCAGTCTTGGGTTATATTTTTGG - Intergenic
1094034522 12:26053391-26053413 TCTTTCTTGGGATAAAATTAAGG - Intronic
1094094127 12:26684914-26684936 TCTTTACAGGCTTATATTGATGG + Intronic
1094152501 12:27301017-27301039 TTCTGCTAGGTTTATATTTAGGG + Intronic
1095568282 12:43651708-43651730 TCTTCCTAGGGTTTTGTATATGG - Intergenic
1095801782 12:46276322-46276344 TCTTTATTTGGTTATATTTTAGG + Intergenic
1097844069 12:64348660-64348682 TCTTCCTCAGGTTATATTTTAGG + Intronic
1098160496 12:67644635-67644657 TCTTCCTAGGGTTAGGTTTATGG - Intergenic
1098915105 12:76249193-76249215 TCTTTGTTGGGTTAGATTTTTGG - Intergenic
1099741875 12:86648116-86648138 TCAATCTAGGTTTATGTTTAGGG + Intronic
1100213875 12:92427542-92427564 TCTTTGTTTGGTTATATTCAGGG + Intronic
1101341710 12:103847852-103847874 TCTTTCTAGATGTATTTTTATGG - Intergenic
1102886252 12:116524371-116524393 TTTTTCCCGGGTTAAATTTATGG + Intergenic
1104281615 12:127383129-127383151 TCTTTGTTGGGTGATATTTAAGG - Intergenic
1106167932 13:27265555-27265577 TGTTTCTCGGGTTATCTGTAGGG - Intergenic
1107575796 13:41720725-41720747 TCTTTCTAGGGTTTTCTTGGAGG + Intronic
1108443167 13:50477020-50477042 TCTTTCTATTTTTATATTTTTGG + Intronic
1108879183 13:55087956-55087978 TCTCCCTAGTATTATATTTAGGG + Intergenic
1108917355 13:55631244-55631266 TTTTTCCAGGGATAGATTTAGGG + Intergenic
1110584083 13:77167650-77167672 TAATACTATGGTTATATTTAAGG + Intronic
1110651431 13:77946844-77946866 ACTGTCTAGGGTGATTTTTATGG - Intergenic
1111368003 13:87275738-87275760 TCTTTCTTGCGTGATATTCAGGG + Intergenic
1113268954 13:108651365-108651387 TCTTTCTAGGGTTCGTTTCAGGG - Intronic
1114258835 14:21023642-21023664 GATTTCTCGGGCTATATTTAGGG + Intronic
1117840703 14:59857771-59857793 TCTTTGCAGGCTTATATGTAAGG - Intronic
1120125917 14:80743030-80743052 TTTTTCTTTGTTTATATTTATGG - Intronic
1120373448 14:83668703-83668725 TTCTTCTAGGGTTTTTTTTATGG - Intergenic
1126144769 15:45464247-45464269 TCTTTCTCGGGTTCTCTTTCTGG + Intergenic
1126200530 15:45980591-45980613 GATTTCTAGAGGTATATTTAGGG - Intergenic
1126366398 15:47899044-47899066 TATTTCTAGGATTTTATTTGAGG - Intergenic
1127490495 15:59457716-59457738 TCTCTCTAGTGTTTTATTTTTGG - Intronic
1130043179 15:80422751-80422773 TATTTCTAGAGTAATAATTAAGG + Intronic
1130363816 15:83214734-83214756 ACTTACTTGGGTTATATATATGG + Intergenic
1131076684 15:89499631-89499653 TTTTTCTTGGGTTACATTTCTGG + Intergenic
1131341540 15:91606953-91606975 TCTTTCTGGGATTCTATTAATGG + Intergenic
1131590353 15:93741310-93741332 TCTTTCTAGGGGTATGTACAGGG + Intergenic
1133639896 16:7706725-7706747 TGTTAATAGGGTTATTTTTAAGG - Intronic
1134151350 16:11807706-11807728 TCCTTCAAGTGTAATATTTAAGG + Intergenic
1135591139 16:23705983-23706005 GCTTTCAGGGGTTATATATAGGG + Intronic
1138233322 16:55357350-55357372 TTTGTCTAGGGTTATACTTCTGG + Intergenic
1138777998 16:59748407-59748429 TCTTTGTAGATTTATATTCAGGG + Intronic
1143468479 17:7155424-7155446 TGTTTCAAAGGTTTTATTTATGG + Intergenic
1144046201 17:11456758-11456780 TCTCTTTAGGGCTATATTTCTGG + Intronic
1144300614 17:13920166-13920188 ACTTTCTAACTTTATATTTACGG + Intergenic
1154008277 18:10553954-10553976 TCTGTGCAGGTTTATATTTAAGG - Intergenic
1156052706 18:32956625-32956647 TCTTTCCAGGGTTATTTGTGAGG + Intronic
1156164356 18:34400190-34400212 TCTTTCTAATGTGATATTTGGGG - Intergenic
1157644089 18:49249234-49249256 TCTCTCTTGTGTTACATTTAAGG - Intronic
1157750699 18:50175530-50175552 TTTTTTTAGGTTTATTTTTATGG + Intronic
1159445373 18:68535792-68535814 TCTTTCTTGTTTTATATTTATGG - Intergenic
1159445600 18:68538120-68538142 TCTTTCTTGTTTTATATTTATGG - Intergenic
1159445798 18:68540298-68540320 TCTTTCTTGTTTTATATTTATGG - Intergenic
1162273944 19:9638434-9638456 TATTTCTAGGGCTGTCTTTAAGG + Intronic
1162354733 19:10175424-10175446 CCTGTCTAGGGCTCTATTTAGGG - Intronic
926262782 2:11282713-11282735 TCTTTCTTGGGTTATGTCTTTGG - Intronic
927387039 2:22546557-22546579 GCTTTCTAAGGTCATATTCAAGG - Intergenic
927721582 2:25386635-25386657 TCTTTCCTGGGTTTTATGTAAGG + Intronic
929003636 2:37373275-37373297 TCTTTGTAGAGTTAATTTTATGG + Exonic
929053952 2:37860007-37860029 TCTTTAAAGTGTTTTATTTAGGG + Intergenic
930698685 2:54437861-54437883 TATTTCTAGGATCATATTTTGGG + Intergenic
930856305 2:56022367-56022389 CCTTTCTAGGGTTTTATTATTGG + Intergenic
931221363 2:60291071-60291093 TATGTCTAGGCTTATTTTTAAGG + Intergenic
933857804 2:86434230-86434252 TCTTACTATGTTTATAATTAAGG - Intergenic
934699324 2:96427174-96427196 CCTTTCCTGTGTTATATTTAGGG + Intergenic
937768244 2:125686713-125686735 GCTTTTTAGCTTTATATTTAGGG - Intergenic
939519426 2:143210977-143210999 TCATTCTTGAGCTATATTTAAGG + Intronic
939901898 2:147860455-147860477 TCTTTTTAAAGTTATATTAAGGG + Intronic
939948547 2:148440552-148440574 TCTATCTATGGTTATATTTTAGG + Intronic
940190041 2:151031124-151031146 TTTTTCTAGAATTATATTTCTGG + Intronic
940453491 2:153870203-153870225 ACTTTCTAGGGTGATACTTTGGG + Intergenic
941274590 2:163474938-163474960 TCTTTCTTGGCTGATATTTCTGG + Intergenic
941937209 2:170993130-170993152 TCTTTCACTGGTTATATTAAAGG - Exonic
942860797 2:180609246-180609268 CCATTCTAGGATTTTATTTAAGG - Intergenic
943919526 2:193686024-193686046 TCTTTCTTGTTTTATTTTTAAGG + Intergenic
944292731 2:198025995-198026017 TCTTTATAGGTTTAGTTTTAAGG + Intronic
944309472 2:198217654-198217676 TTTTTCCAGGATTATATTTTTGG + Intronic
947459056 2:230286707-230286729 TCTTTCTAAGGTTACATATGTGG + Intronic
947640935 2:231707660-231707682 TCATTCTAGGTTTCTAGTTAGGG - Intronic
948248543 2:236506851-236506873 TCTTTCTAGACTTAAATTTCAGG + Intronic
1170079663 20:12459378-12459400 CATTTCTAGGATTATATTTCTGG - Intergenic
1170250858 20:14280810-14280832 TATCTCCTGGGTTATATTTAAGG - Intronic
1170258310 20:14372477-14372499 TCTTTTTAGTGGTATATTTTTGG + Intronic
1171095785 20:22331367-22331389 CCTTTATAGGGTTGTAGTTACGG - Intergenic
1172952672 20:38731772-38731794 TCTTTCTAGTGCTTTATTTCAGG + Intergenic
1173089426 20:39956009-39956031 TCCTTCCAGGGTTAGATTTTTGG + Intergenic
1175751897 20:61504407-61504429 TCTATCTAAGGTCATGTTTAAGG - Intronic
1176366578 21:6036617-6036639 TCTATCTAGGGTTCTGTCTAGGG - Intergenic
1177834525 21:26173558-26173580 ACTTTGTAGGGTTATAACTAGGG - Intergenic
1178612705 21:34098924-34098946 TTTTACTAGGCTTGTATTTAGGG + Exonic
1179756939 21:43501928-43501950 TCTATCTAGGGTTCTGTCTAGGG + Intergenic
1184928019 22:47657752-47657774 TATTTACTGGGTTATATTTAAGG + Intergenic
951088302 3:18540966-18540988 TCTTTCTAGTTTTATATAAATGG - Intergenic
951512934 3:23524737-23524759 TCTTTCTAGAATTATTTTTAAGG + Intronic
953004325 3:38963957-38963979 TCTTTCTAGCTTCATCTTTAAGG + Intergenic
956656945 3:71561711-71561733 TCTGTCTAGGATCATATATAAGG - Intronic
957185128 3:76931648-76931670 TCAGTCTAGTATTATATTTACGG + Intronic
957726107 3:84069595-84069617 TCTTTCTAGCCTAATATTTTAGG - Intergenic
958729238 3:97943327-97943349 TCTTTCTAGGGATCTTTCTAGGG - Exonic
958879030 3:99648579-99648601 TCTCCCTAGGGTAATTTTTAAGG + Intronic
960439272 3:117666764-117666786 TCTTTCAAGTGTCATGTTTAGGG - Intergenic
960655351 3:119997932-119997954 TTTTTCTGGGGTTATATTTTGGG - Intronic
963872815 3:150437022-150437044 CCTTTATAGTGTTTTATTTAGGG + Intronic
964061884 3:152535305-152535327 TCTTTTCAGGGATATATTTTAGG + Intergenic
966775311 3:183538318-183538340 TGTTTATAGGGTTAGAATTAGGG - Intronic
968711812 4:2125021-2125043 TCTTTCTAGGGTTATATTTAGGG + Intronic
970041386 4:11800974-11800996 TCTTTCTCATGTAATATTTAAGG - Intergenic
970984570 4:22141215-22141237 TCTTGCTAGGGTATTATTTAAGG - Intergenic
973695748 4:53488982-53489004 TCATTCTAGAGTTATATTTCTGG - Intronic
975496732 4:75043846-75043868 TGTTTCTGGGTTTCTATTTATGG + Intronic
976699500 4:87953953-87953975 TCTTTCTGAGGTTATGCTTATGG + Intergenic
977234806 4:94495235-94495257 TCTTACTAGGATTATACTAAAGG + Intronic
977445730 4:97129494-97129516 TCTTTCTGGGTTTTTATTTTAGG - Intergenic
978225768 4:106333175-106333197 TTCTGCTAGTGTTATATTTACGG + Intronic
978381783 4:108136066-108136088 TCTTTCAAGGGTTAAAATTCAGG + Intronic
980225723 4:129982222-129982244 TTTTCCTAATGTTATATTTAGGG - Intergenic
980398302 4:132245284-132245306 TCTTTCTAAAGCCATATTTAGGG + Intergenic
980714651 4:136614096-136614118 TGTTTCTAGGGCTGTCTTTAAGG - Intergenic
982143694 4:152358224-152358246 TCTTTCCTGGGTCATATTTGTGG - Intronic
983104789 4:163673186-163673208 TATTTCTAGGAATATATTTCTGG + Intronic
983116507 4:163824168-163824190 TCTTTCAAAGCTCATATTTATGG + Intronic
983336961 4:166408358-166408380 TGTTTCTAAAGTTATATTAAGGG + Intergenic
983712763 4:170740022-170740044 TCTTTCTAGGTTTCCATTTAGGG - Intergenic
984311004 4:178058025-178058047 TTGTTCTAGAGTTATATTTTGGG + Intergenic
986022090 5:3813678-3813700 TTTTTCTAGGGCTCTATCTAGGG - Intergenic
988125831 5:27034791-27034813 TCTTACTAGTGCTAAATTTAGGG + Intronic
989150401 5:38293643-38293665 GTTTTATAGGGTTATATATAGGG + Intronic
989646645 5:43641032-43641054 TCTTTCTAGAGTTTAACTTATGG + Intronic
989809349 5:45654169-45654191 TAATTCATGGGTTATATTTAGGG - Intronic
990287760 5:54316868-54316890 TCTTTCAAGGCTTACATATAAGG + Intergenic
992738016 5:79743206-79743228 TGTTGCTAGGTTTATAATTACGG + Intronic
992772341 5:80060257-80060279 TTTTTCTAAGGGTATATTTCAGG + Intronic
993198075 5:84776457-84776479 TCTTTCCAGGGTGATATTGGAGG - Intergenic
993461183 5:88184154-88184176 TCTTTTGAGGCTTGTATTTAAGG - Intergenic
993793711 5:92239319-92239341 TCTTTCTACATTTATATTTTGGG - Intergenic
994478058 5:100295892-100295914 TCTTTCTAGGCTTATGGTAAAGG - Intergenic
996625646 5:125567425-125567447 TTTTTCTAGAATTATATTTTGGG + Intergenic
997157552 5:131575691-131575713 TGTTTCTAGGGCTGTCTTTAAGG - Intronic
998754833 5:145365798-145365820 TCTTTCTAGGGTTAATTTTCTGG + Intergenic
999333961 5:150699339-150699361 CATTTCTTGGGTTATGTTTAAGG - Intronic
999820104 5:155218925-155218947 TTTTTCCAGAATTATATTTATGG + Intergenic
999905705 5:156139297-156139319 TATCTCTAGCTTTATATTTAGGG + Intronic
1000415283 5:160977795-160977817 TGTTTATGGGGTTATATTTCTGG + Intergenic
1003888038 6:10538517-10538539 TCTATCAGGGTTTATATTTAAGG - Intronic
1004587061 6:17012916-17012938 TCTTTCTTCTGTTATTTTTACGG - Intergenic
1004873542 6:19932150-19932172 TCTTTCTAGGATTTAAATTAAGG + Intergenic
1005557855 6:27006718-27006740 TGTGTCCAGGGTTAGATTTATGG - Intergenic
1008841375 6:55909190-55909212 TATTTCTAATGTTATATTTTGGG - Intergenic
1009695059 6:67091914-67091936 CTTTTATATGGTTATATTTATGG - Intergenic
1010212356 6:73372099-73372121 TTTTTTTAGGTTTATTTTTAGGG - Intronic
1010984204 6:82403522-82403544 TCTTTCCAGGGTTATTTTTATGG + Intergenic
1011677911 6:89753609-89753631 TCTTTCTAGGGTTTTTGTTTGGG - Exonic
1012431433 6:99167645-99167667 TCCTTTTAGGGTCATAGTTATGG - Intergenic
1014678376 6:124397127-124397149 TGTATTTAGAGTTATATTTAGGG - Intronic
1017054057 6:150422220-150422242 TCTAGCTAGGGTTATTTATATGG - Intergenic
1017536268 6:155350302-155350324 CCTTCCTAGGGATATATTCAGGG + Intergenic
1018004264 6:159605658-159605680 TCTATCTAAGGTTACATTTCAGG - Intergenic
1018369348 6:163153706-163153728 TCTTTCTTAGTTTGTATTTATGG - Intronic
1021087359 7:16437719-16437741 ACTTTCTTGGGTTATATATTTGG - Intergenic
1021238289 7:18170551-18170573 TTCTTCTAGGGTTTTTTTTATGG + Intronic
1022662749 7:32381749-32381771 TCTTTCAAGGATAATATGTAAGG - Intergenic
1022838819 7:34143154-34143176 CCTTTCTGAAGTTATATTTAGGG + Intronic
1023775623 7:43603608-43603630 TCTTTCTGGGATAATATATAAGG - Intronic
1024889168 7:54181416-54181438 TTTTTCCAGGGTTATGTTTCTGG + Intergenic
1025596690 7:62937393-62937415 TCCTTCTAGGTTTATTTTTCTGG + Intergenic
1026649915 7:72207643-72207665 TCTTACAAGGCTTATATTTTTGG - Intronic
1027504738 7:79002081-79002103 TCTTTCTACGATTAGATTTCAGG - Intronic
1030129665 7:106188060-106188082 TCTTTCAGAGGTTATTTTTAAGG + Intergenic
1031297628 7:120023475-120023497 TCTTTCTAGTGCTTTATTTGTGG + Intergenic
1031651221 7:124292355-124292377 TAGTTCTAGAGTTATATTTCTGG + Intergenic
1032737651 7:134707347-134707369 TGTTTCAAGTGTAATATTTAAGG + Intergenic
1033432889 7:141305220-141305242 TATTACTAGGGTTATAATCATGG - Intronic
1033441159 7:141380060-141380082 TGTTTTTAGATTTATATTTATGG - Intronic
1037846227 8:22284735-22284757 ACAGTCTAGGGTTAAATTTAGGG + Intronic
1038228670 8:25680523-25680545 TCTTTCCAGCCTCATATTTAGGG - Intergenic
1038576310 8:28706221-28706243 ACTTTCTAGGAATATATTTTAGG - Intronic
1038838885 8:31160483-31160505 ACTTTGTAGGATTAGATTTATGG + Intronic
1039001667 8:32988075-32988097 TTTGTCTAGGGCTATATTTTAGG - Intergenic
1040698063 8:50026665-50026687 TCATTCAAAAGTTATATTTATGG + Intronic
1041000770 8:53449572-53449594 TCTTTCTAAAGGTATAATTAAGG - Intergenic
1042111398 8:65385051-65385073 TTCTTCTAGGGTTTTTTTTATGG - Intergenic
1042595094 8:70438999-70439021 TTTTTCTAAGGTTATCCTTAGGG + Intergenic
1044343553 8:91075673-91075695 TTTTTACAGGGTTATATTAATGG + Intronic
1045276428 8:100710224-100710246 TCTTTATACCGTAATATTTATGG - Intronic
1046245342 8:111552884-111552906 TATTTCTAGGTTGTTATTTAAGG + Intergenic
1047590569 8:126322577-126322599 TCCTTCTAAAGATATATTTATGG + Intergenic
1048672278 8:136736568-136736590 TCTTTCTAGGTTAACATTTTTGG + Intergenic
1049511821 8:143031263-143031285 CCTTTCCAGGTTTGTATTTATGG - Intergenic
1050096407 9:2071975-2071997 TCTTTTTAAGGTTATTTTTGTGG + Intronic
1050452053 9:5792314-5792336 TCTTTCTAGGATATTCTTTATGG - Intronic
1051112887 9:13660246-13660268 CATTTCTAGGGTTATTTCTAGGG + Intergenic
1052381826 9:27779959-27779981 TTCTTCTAGGGTTTTTTTTATGG + Intergenic
1052477331 9:28976556-28976578 TCTTACTAGACTTAAATTTAAGG + Intergenic
1053515474 9:38727082-38727104 TCTTTCTAGGGTCAAATCTATGG - Intergenic
1058120048 9:101128151-101128173 TGTGTCTAGAGATATATTTAAGG + Intronic
1058275928 9:103040691-103040713 TCTATTTAGGATTCTATTTAAGG - Intergenic
1058657872 9:107240889-107240911 TCTTTGTCAGGTTATATTAATGG + Intergenic
1058873846 9:109224985-109225007 TCTGTCTTGGCTTCTATTTAAGG + Intronic
1061717645 9:132530797-132530819 TCTTTCATGGGTTATATTTTTGG + Intronic
1186076534 X:5885968-5885990 AATTTTTAGGGTTATATTTTGGG + Intronic
1186876370 X:13822030-13822052 ACTTTCTAGGATGATATTTTAGG + Intronic
1187360753 X:18625510-18625532 TCTTTCCTGGGCTGTATTTATGG - Intronic
1188088498 X:25933069-25933091 TACTTCTAAGGTTATAATTAAGG - Intergenic
1189058285 X:37723692-37723714 TATTTATATTGTTATATTTATGG - Intronic
1189142370 X:38620266-38620288 TCTTTACAGGGTGGTATTTAGGG - Intronic
1189169278 X:38893241-38893263 TGTTTTGAGGGTTATATTTCTGG - Intergenic
1191947251 X:66548454-66548476 TCTTTCTAGGTGTGTATATAGGG + Intergenic
1192764281 X:74126368-74126390 TGTTTCTAGGGTTGTCTTTAAGG + Intergenic
1192958388 X:76098623-76098645 TATTTATATGGTTATATATATGG + Intergenic
1193227891 X:79007401-79007423 TCTTTTTAGTGTTAAAATTAGGG + Intergenic
1193822141 X:86178596-86178618 ATTTTCTAGGCTTCTATTTAGGG - Intronic
1195229588 X:102832531-102832553 CCTTAATAGGGTTATATTTGCGG - Intergenic
1196088327 X:111710501-111710523 TTTTTCTAGAGTTTTATATAAGG - Intronic
1198564657 X:137891911-137891933 TACTTATAGGGTTATAGTTAAGG + Intergenic
1200845334 Y:7826675-7826697 TTTTGCCAGGGTTATATTTCAGG - Intergenic
1200977362 Y:9227520-9227542 GCATTTTAGGGTTATTTTTAGGG - Intergenic
1202133451 Y:21635371-21635393 GCATTTTAGGGTTATTTTTAGGG + Intergenic
1202256520 Y:22927267-22927289 TCTTTGTAGGCATATATTTGAGG + Intergenic
1202409510 Y:24561020-24561042 TCTTTGTAGGCATATATTTGAGG + Intergenic
1202461271 Y:25109057-25109079 TCTTTGTAGGCATATATTTGAGG - Intergenic