ID: 968724860

View in Genome Browser
Species Human (GRCh38)
Location 4:2242082-2242104
Sequence GCACGGAGGGCGGTGGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 1, 2: 1, 3: 49, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968724860_968724874 13 Left 968724860 4:2242082-2242104 CCCGCCGCCACCGCCCTCCGTGC 0: 1
1: 1
2: 1
3: 49
4: 416
Right 968724874 4:2242118-2242140 CACTGCCTCACGGGAGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 109
968724860_968724871 3 Left 968724860 4:2242082-2242104 CCCGCCGCCACCGCCCTCCGTGC 0: 1
1: 1
2: 1
3: 49
4: 416
Right 968724871 4:2242108-2242130 GCGCGCCTCGCACTGCCTCACGG 0: 1
1: 0
2: 0
3: 5
4: 62
968724860_968724872 4 Left 968724860 4:2242082-2242104 CCCGCCGCCACCGCCCTCCGTGC 0: 1
1: 1
2: 1
3: 49
4: 416
Right 968724872 4:2242109-2242131 CGCGCCTCGCACTGCCTCACGGG 0: 1
1: 0
2: 1
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968724860 Original CRISPR GCACGGAGGGCGGTGGCGGC GGG (reversed) Exonic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900265623 1:1755723-1755745 GCACGGAGGGCTGGGGGAGCTGG + Intronic
900384047 1:2401300-2401322 GGAAGGAGGGAGGAGGCGGCAGG - Intronic
900393519 1:2443894-2443916 GCAGCGAGGGCGGCGGGGGCGGG - Intronic
900420608 1:2554455-2554477 GGACGGAGGGCCGAGGCGGGCGG + Intergenic
900432826 1:2611156-2611178 ACACGGCGGGCGGTGGAGCCGGG - Intronic
900491697 1:2952492-2952514 GCATGGAGGGTGGTTGCTGCAGG + Intergenic
900650577 1:3728146-3728168 GCACCAAGGGCGGGGACGGCAGG - Exonic
900786770 1:4654657-4654679 GCGCGGTGGGCGCGGGCGGCGGG + Intergenic
901084624 1:6602974-6602996 TCGCGGGGGGCGGTGGCGCCCGG - Intronic
902210792 1:14903113-14903135 GCACTGTGGGAGGTGGAGGCGGG - Intronic
902375922 1:16029904-16029926 GGATGGAGGGCTGTGGGGGCCGG + Intronic
902380867 1:16051649-16051671 GGATGGAGGGCTGTGGGGGCCGG + Intronic
902415636 1:16237115-16237137 GCCCGGCGGGCTGGGGCGGCGGG - Exonic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903132768 1:21290327-21290349 GCCTGGAGGGCGGGGGCGGGAGG - Intronic
903339023 1:22642788-22642810 GCAAGGAGGGTGGTGTTGGCAGG + Intergenic
903925139 1:26826635-26826657 CCGCGGCGGGCGGTGGCGGCGGG + Intergenic
904190307 1:28737721-28737743 GGACGCGGGGCGGTGGGGGCGGG + Intronic
904320792 1:29696819-29696841 GCATGGAAGGGGATGGCGGCCGG + Intergenic
905010351 1:34742794-34742816 GCTCTGAGGGCGGAGGCTGCAGG + Intronic
905090484 1:35427271-35427293 GCAGGGAGGGCAGTGGAGACTGG + Intergenic
905580730 1:39081483-39081505 GCAGCGAAGGCGGCGGCGGCCGG - Intronic
906027026 1:42682608-42682630 GCGCTGAGGGCGGGGGCGGCGGG - Exonic
906260117 1:44380615-44380637 GCCTGGAGGGCAGTGGGGGCGGG - Intergenic
906277100 1:44524440-44524462 GGAAGGAGGGAGGTGGGGGCTGG - Intronic
907190871 1:52647597-52647619 GCACTTAGGGAGGTGGAGGCGGG + Intronic
909611719 1:77557894-77557916 GAACAGAGGGCGGTGGGGGGTGG - Intronic
912682529 1:111738566-111738588 GCAGGGAGGGGGCTGGCAGCTGG - Intronic
914196098 1:145448840-145448862 GCTGGGAGGGTGGTGGGGGCAGG - Intergenic
915215776 1:154339933-154339955 GCACTTTGGGCGGTGGAGGCGGG + Intronic
915463190 1:156081737-156081759 GCGCCGCGGGCGGCGGCGGCGGG + Exonic
915615761 1:157036877-157036899 GCACTGTGGGAGGTGGAGGCGGG + Intronic
916048897 1:161021177-161021199 GCGCGGAGGGCGGGGCCGGGCGG - Exonic
916179252 1:162069904-162069926 GCAGGGGAGGAGGTGGCGGCGGG - Exonic
917797577 1:178542917-178542939 GAACGGAGGGCTCAGGCGGCCGG + Intronic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
918417163 1:184322456-184322478 GGATGGGGGGAGGTGGCGGCGGG - Intergenic
919811916 1:201414224-201414246 GCATGGAGTGGGGAGGCGGCCGG - Intronic
920026808 1:203004854-203004876 GCACCTAGGGAGGTGGAGGCGGG - Intergenic
920367726 1:205456917-205456939 GCGCGGAGGGCGGGGTGGGCCGG - Intergenic
920511786 1:206557239-206557261 GGAGGGAGGGCGCTGGCGCCGGG + Intronic
920922737 1:210311572-210311594 ACACGGAGGGCGGGGGCGGGGGG + Intergenic
921839128 1:219809751-219809773 GCAGGAAATGCGGTGGCGGCTGG - Intronic
922322817 1:224503047-224503069 GGAGGGAGGGAGGTGGGGGCAGG + Intronic
922798273 1:228352186-228352208 ACACGGCGGGAGGTGGTGGCCGG - Intronic
923441735 1:234027245-234027267 CCACAGAGGGCAGTGGCAGCTGG + Intronic
923744304 1:236686410-236686432 GGGCCGGGGGCGGTGGCGGCGGG + Intergenic
924052290 1:240091769-240091791 GCAGAGGGGGCGGCGGCGGCGGG + Intronic
1062838876 10:654097-654119 GCAGTGAGGGCAGTGGCGTCAGG + Intronic
1062904578 10:1171057-1171079 GCACGGAGGGCTGAGTGGGCAGG + Intergenic
1063510325 10:6638377-6638399 GCACTGTGGGAGGTGGAGGCAGG + Intergenic
1064694800 10:17954498-17954520 GCACTTTGGGAGGTGGCGGCAGG - Intronic
1065478249 10:26164503-26164525 GTACGGAGGGCAGGGGCTGCTGG + Intronic
1066180469 10:32957553-32957575 GCGCCGCGGGCGGGGGCGGCGGG - Intronic
1066419509 10:35251148-35251170 GCACGTTGGGAGGTGGAGGCAGG + Intronic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1067416354 10:46106239-46106261 GCCAGGAGAGCGGAGGCGGCGGG + Intergenic
1069800043 10:71076359-71076381 CGACGGAGGGCTGTGGCTGCAGG + Intergenic
1070515980 10:77206806-77206828 GCAGGGAGGGAGGGGGGGGCGGG + Intronic
1070807809 10:79280798-79280820 ACACAGAGGGAGGTGGAGGCAGG - Intronic
1071532890 10:86402378-86402400 GGAGGGAGGGCGGTGGCAGGAGG + Intergenic
1072784166 10:98268806-98268828 ACACGGAGGGCGGGGGGGGGGGG - Intergenic
1073190951 10:101650414-101650436 GCTCTGAGGGAGGTGGGGGCAGG - Intronic
1074095041 10:110304558-110304580 GCACGGAGGCCAGCGCCGGCCGG + Intronic
1074503132 10:114044026-114044048 GCGCAGAGGGAGGTCGCGGCCGG - Intergenic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1075652757 10:124140003-124140025 GCACGCAGGGCGGCCGAGGCAGG + Intergenic
1076189364 10:128472251-128472273 CCACGGTGGGCTGTGGCAGCTGG - Intergenic
1076606427 10:131692488-131692510 CCACGGAGTGCTGTGGCAGCAGG - Intergenic
1076841585 10:133048564-133048586 GCCCGGAGGGTGGAGGCAGCAGG + Intergenic
1076842058 10:133050548-133050570 GCAGGGAGGGCGGTGGCTCTGGG + Intergenic
1077228950 11:1450238-1450260 GCTCGGGGGGCGGTGGGGGCAGG - Intronic
1077500789 11:2909063-2909085 GGATGGAGGGCGGGGGCGCCTGG - Intronic
1078225131 11:9384856-9384878 GCCCGGCTAGCGGTGGCGGCGGG + Intronic
1079180418 11:18188920-18188942 GCGCTGACGGCGGTGGCGGGGGG + Exonic
1080696059 11:34603865-34603887 GCACTGAGTGCAGTGGCTGCTGG + Intergenic
1082044694 11:47715332-47715354 TCACAGAAGGCGGTGGCGGGCGG - Exonic
1083628782 11:64085405-64085427 GGACGGAGGGCGGGGGAGACTGG + Intronic
1083656986 11:64234572-64234594 GCGGGGACGGCGGGGGCGGCGGG - Exonic
1083673610 11:64313787-64313809 GCAGGGAGGGGAGTGGCTGCTGG - Intronic
1083800080 11:65041493-65041515 GCACGGAGGGCGGACGCAACTGG - Exonic
1084128703 11:67118231-67118253 GGCCCGGGGGCGGTGGCGGCCGG - Intergenic
1084485067 11:69443400-69443422 GCAAGGTAGGCGGTGGCTGCAGG + Intergenic
1084500761 11:69533876-69533898 GCAGTCAGGGCGGTGGTGGCAGG + Intergenic
1084672022 11:70612645-70612667 GCAGGGAGGAAGGTGGCTGCCGG - Intronic
1085095963 11:73760868-73760890 GGAAGGAGGGCGGTGTCGGCAGG + Exonic
1085691511 11:78667952-78667974 GCTGGGAGGGCTGTGGCTGCTGG + Intronic
1089432650 11:118436556-118436578 CCACCGGGGGCGGCGGCGGCGGG + Exonic
1089610711 11:119667030-119667052 GCACCGAGGATGGTGGTGGCAGG - Intronic
1091714920 12:2770225-2770247 GCATGGAGGGCAGTGGGGGCAGG - Intergenic
1093652142 12:21657838-21657860 GCAAGGAGGGAGGAGGGGGCGGG + Intronic
1095752955 12:45730274-45730296 GCACGGAGGCGGACGGCGGCGGG + Intronic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1096204196 12:49707389-49707411 GCAAGGCGGACGGAGGCGGCCGG + Exonic
1096241229 12:49961470-49961492 GCACGGAGCGCGGTAAAGGCCGG + Intergenic
1096494210 12:52029959-52029981 GCCCTCAGGGCGGTGGCTGCTGG + Intronic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1097062455 12:56295706-56295728 GCACTGTGGGAGGTGGAGGCGGG + Intronic
1097836130 12:64274237-64274259 GCAGGGAGGGGGGTGGTGGTGGG + Intronic
1100423542 12:94460344-94460366 GAAGGGAGAGAGGTGGCGGCAGG - Intergenic
1101963054 12:109264465-109264487 GCGGGGAGGGCGGTGGTGGTTGG + Intronic
1102017431 12:109657042-109657064 GCACTGGGGGCTGGGGCGGCTGG - Intergenic
1102124457 12:110468997-110469019 GGACCGAGGGTGGCGGCGGCGGG + Exonic
1103488201 12:121296750-121296772 GCGCGGGGGGCGGGGGCGGGAGG + Intronic
1104983384 12:132583611-132583633 GCGCCGAGGGCGGCGGCGGCGGG - Exonic
1105846635 13:24299485-24299507 ACACGGAGGGCCTTGGAGGCAGG + Intronic
1113666329 13:112144058-112144080 GCATGGGGGGCAGGGGCGGCTGG - Intergenic
1113794767 13:113050710-113050732 GCAGGGGGGGCGGGGGCGGGGGG + Intronic
1113794792 13:113050751-113050773 GTGCGGGGGGCGGTGGCGGGGGG + Intronic
1113887640 13:113669343-113669365 GGAGGGAGGGCTGTGGCTGCAGG + Intronic
1113962306 13:114132712-114132734 GCAGGGACGGCGCTGGCGGGTGG + Intergenic
1114620565 14:24094050-24094072 GCTGGGAGGGCGGTGGCGGATGG + Intronic
1114646826 14:24260628-24260650 GCAAGGGGGGCAGTGGAGGCTGG - Exonic
1115028326 14:28767206-28767228 GCGCGGCGGGCGGCGGCGACCGG - Exonic
1115399191 14:32938950-32938972 GCATGGACGGCGGCGGCGCCGGG + Intronic
1115556151 14:34546502-34546524 GCACGGCGCGCGGAGGCTGCCGG + Intergenic
1115557757 14:34556579-34556601 GCACGGCGCGCGGAGGCTGCCGG - Intergenic
1115753560 14:36513633-36513655 GCCAGGAGGGGGGTGGGGGCAGG - Exonic
1115754659 14:36519253-36519275 GCATGGAGGGCGGCGGCCTCGGG - Exonic
1115906642 14:38209313-38209335 GGAGGGAGGGCGCAGGCGGCGGG + Exonic
1116871483 14:50072829-50072851 GGGCGGAGGGCGGTGGGGGGGGG + Intergenic
1117391407 14:55266335-55266357 GCACTGGGGGTGGTGGGGGCGGG - Intergenic
1118463907 14:66013737-66013759 GCGCTGAGGGCGGGGGCGGCGGG + Intergenic
1119410282 14:74426091-74426113 GCGGGGCGGGCGGCGGCGGCGGG - Exonic
1119781717 14:77280319-77280341 GCAGGGAGACCGGTGGAGGCGGG - Intronic
1121453727 14:94025609-94025631 GCGCGGGGGGCGGGGGCGGGGGG + Intergenic
1121899815 14:97683751-97683773 GCAGGGATGGTGGTGGCGGTAGG + Intergenic
1122746491 14:103900011-103900033 GCACGGTGGGTGGTGTGGGCAGG + Intergenic
1122817765 14:104321933-104321955 GCACTGGGGGCGGGGGCGGCTGG + Intergenic
1122822298 14:104353692-104353714 GCACGGAGGGAAGGGGCGGGAGG + Intergenic
1122843757 14:104479429-104479451 GCACCGAGGGAGGTGGGAGCTGG - Intronic
1122889046 14:104724209-104724231 GCGCGGACGCCGGCGGCGGCGGG + Intronic
1123114071 14:105885968-105885990 GCAGGGAGGGCTGTGGTGGGAGG + Intergenic
1123118246 14:105904434-105904456 GCAGGGAGGGCTGTGGCGGGAGG + Intergenic
1123684337 15:22786633-22786655 GCTCGGAGGGCGGGCGCGGGCGG + Exonic
1124212699 15:27776550-27776572 CCACGGAGGCCGGTGTGGGCTGG - Intronic
1124322581 15:28726144-28726166 GCACCCAGGGAGGTGGAGGCAGG - Intronic
1124453773 15:29822247-29822269 GCTCGGAGGGAGGTGCCGGTCGG - Exonic
1124469322 15:29968971-29968993 CCACGCACGGCGGCGGCGGCGGG - Intergenic
1125479488 15:40070340-40070362 GCCCTGAGGGCTGTGGCTGCTGG + Intergenic
1125485602 15:40108802-40108824 GCAGGGGCGGCGGCGGCGGCGGG + Exonic
1125500842 15:40239567-40239589 GCCCGGGGGGCTGTGGCAGCAGG + Exonic
1127207230 15:56733427-56733449 GCAGGGCGGGCGGGGGCGGGGGG + Intronic
1128750058 15:70142485-70142507 GCAGGGTGGGGGGTGGCGGCGGG - Intergenic
1129665135 15:77575399-77575421 GAAGGGAGGGCGGTGGCCACTGG + Intergenic
1129983006 15:79891719-79891741 GCACTTAGGGAGGTGGAGGCGGG + Intronic
1130549504 15:84881019-84881041 GCACGCAGCGCGGTGGCCCCTGG + Intergenic
1131263741 15:90903441-90903463 AGCCCGAGGGCGGTGGCGGCGGG + Intronic
1131831093 15:96354788-96354810 GCTTGGAGGGAGGTGGGGGCCGG - Intergenic
1131832873 15:96365588-96365610 GGACGGAGTGGGGTGGGGGCGGG - Intergenic
1132178265 15:99732881-99732903 GCCCGGAGGCGGGAGGCGGCCGG + Intronic
1132590522 16:724460-724482 GTCCGGAGGGCCGTGGTGGCTGG + Exonic
1132634222 16:935339-935361 GCACTTAGGGAGGTGGAGGCAGG - Intronic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1132940161 16:2502405-2502427 GCAGGGACGGGGGTGGGGGCAGG - Exonic
1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG + Intronic
1132968438 16:2673083-2673105 GCGCGGAGGGCGGGGGAGGCCGG - Intergenic
1133029640 16:3004339-3004361 GCAGGGACGGCGGGGGCAGCGGG - Intergenic
1134331152 16:13252206-13252228 GCAAGGAGGCCAGTGGGGGCTGG - Intergenic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1134554646 16:15154817-15154839 GGACGGGGCGCGGTGGGGGCGGG + Intergenic
1136240272 16:28939025-28939047 GCACGGATGGCAGTGGCTGCTGG + Intronic
1136399763 16:30010946-30010968 GCAGGCTGGGCGGCGGCGGCCGG + Exonic
1136550477 16:30979979-30980001 GGGCGGAGGGCGGCGGCGCCGGG - Exonic
1136768430 16:32811388-32811410 GCTCTGAGGGCGGGAGCGGCAGG - Intergenic
1138472946 16:57252609-57252631 GAACAGAGGGTGGTGGCGGCGGG - Exonic
1138507693 16:57486376-57486398 GCGCGGCTGGCGGGGGCGGCAGG + Exonic
1139448687 16:67014121-67014143 GCAGGGAGGGCTGTGGCAGGCGG - Intergenic
1139480322 16:67227005-67227027 GCAGTGGGGGCGGAGGCGGCAGG - Intronic
1139546622 16:67652848-67652870 CCACGGACAGCGGCGGCGGCGGG + Intronic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140777603 16:78264373-78264395 GCAGGGCTGGCGGTGGGGGCGGG - Intronic
1140816269 16:78623619-78623641 GCAGTGAGTGCGGTGGCAGCTGG + Intronic
1141180389 16:81748965-81748987 GCACTGAGGCCTGTGGCGGGGGG + Intronic
1141479126 16:84294694-84294716 GCTCAGTGGGCGGTGGCAGCAGG - Exonic
1141623335 16:85248707-85248729 GCAGGGAGGGGGGTGCTGGCTGG + Intergenic
1141727551 16:85799731-85799753 TCGCGGCGGGCAGTGGCGGCAGG + Exonic
1142037188 16:87869543-87869565 GGACGGTGGGCGGGGCCGGCGGG - Intergenic
1142128063 16:88419924-88419946 GCACAGAGAGGGGTGGAGGCCGG + Intergenic
1142206266 16:88784677-88784699 GCTGGAAGGGCGGCGGCGGCTGG - Intronic
1142261624 16:89045106-89045128 GCAGGGCGGGTGGGGGCGGCAGG + Intergenic
1142262992 16:89051252-89051274 GCAGGGAGGGCTGGGGGGGCGGG - Intergenic
1142395282 16:89828394-89828416 GCGCGGAGGGCGCGGGGGGCGGG - Intronic
1203070822 16_KI270728v1_random:1073404-1073426 GCTCTGAGGGCGGGAGCGGCAGG - Intergenic
1142762866 17:2051666-2051688 GCAGCGAGGGCTGTGGCGTCGGG + Intergenic
1142863835 17:2778607-2778629 GCATGGATGGGGGTGGTGGCAGG + Intronic
1142967732 17:3591656-3591678 GGACGGAGGGAGGTGGAGGCAGG + Intronic
1142978781 17:3659812-3659834 AGACGGAGGGCGGTGAGGGCTGG - Intronic
1143036797 17:4004121-4004143 CCACGGCGGGCGGTGGGGCCAGG + Intergenic
1143094238 17:4468565-4468587 GGGCAGGGGGCGGTGGCGGCGGG + Intronic
1143164193 17:4889814-4889836 GCACGGGGAGCAGGGGCGGCAGG - Intronic
1144778829 17:17797919-17797941 GCAAGGAGGGCCGCGGCTGCAGG - Exonic
1145765641 17:27456684-27456706 AGAAGGAGGGCGGTGGCGGGGGG + Intergenic
1146186672 17:30728824-30728846 GGACGGGGGCTGGTGGCGGCTGG + Intergenic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1147168660 17:38605854-38605876 GCTGGGAGGGCGCCGGCGGCCGG + Exonic
1147994714 17:44354420-44354442 GCCCGGGGGGCGAGGGCGGCGGG - Exonic
1148111722 17:45148338-45148360 GCACGGCGCGCGAGGGCGGCGGG + Intergenic
1149562095 17:57615375-57615397 GCACTGTGGGAGGTGGAGGCAGG - Intronic
1149596711 17:57868568-57868590 GGCGGGAAGGCGGTGGCGGCGGG - Intronic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150562059 17:66302778-66302800 GCCGGGTGGGCGGGGGCGGCGGG - Intronic
1150643449 17:66964574-66964596 ACCCGGAGCGCGGCGGCGGCGGG + Intergenic
1151499831 17:74481583-74481605 GGACGGAGTGGGGTGGAGGCAGG + Intronic
1151836716 17:76586654-76586676 CCACGGAGGGGGGTGGGGGTGGG + Intronic
1152239823 17:79155398-79155420 GCAGGGAGGTCCGGGGCGGCAGG + Intronic
1152528206 17:80901808-80901830 GCAGGGAGGGCGCTGGGGGCGGG - Intronic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152703959 17:81833350-81833372 TGGCGGAGGGCGGGGGCGGCCGG + Intergenic
1152714337 17:81891347-81891369 GCGCGGCCGGCGGAGGCGGCAGG - Exonic
1152789895 17:82273276-82273298 GGGCGGCGGGCGGGGGCGGCGGG + Intronic
1152797719 17:82316265-82316287 GCAGGGAGGGCAGAGGCTGCTGG + Exonic
1156171841 18:34494361-34494383 GGACGGGGGGCGGCGGGGGCGGG + Intronic
1157606383 18:48928600-48928622 GCAAGGAGGGCGGTGATGGGAGG - Intronic
1158717947 18:59897494-59897516 GCACTGTGGGAGGTGGAGGCTGG - Intergenic
1160340330 18:78084099-78084121 CCACGGAAGGTGGAGGCGGCTGG - Intergenic
1160834705 19:1119245-1119267 GCAGAGAGGGCGGGGTCGGCAGG + Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1161160240 19:2757648-2757670 GGACGGAGGACGTGGGCGGCGGG - Intronic
1161273582 19:3403818-3403840 GCGCGGCGGGGGGTGGCGGGAGG - Intronic
1161400476 19:4064910-4064932 GCACGGTGGGCCGCGGCGGGAGG - Intronic
1162403127 19:10457958-10457980 GTACAGGGGGCGGGGGCGGCTGG - Exonic
1162770951 19:12949021-12949043 GCATGGAGGAGGGTGGCAGCAGG + Intronic
1163125993 19:15244456-15244478 GCATGGAGGGTGGGGGAGGCGGG + Exonic
1163423306 19:17227025-17227047 GCACGGAGGGCGGGGGGCGCTGG - Exonic
1163763848 19:19151529-19151551 GTACAGAGGGCGGCGGCTGCAGG - Intronic
1163782508 19:19257865-19257887 GCTGGGCGGGCGGCGGCGGCTGG - Exonic
1164594975 19:29526556-29526578 GCGGGGGGCGCGGTGGCGGCGGG - Exonic
1164834553 19:31349274-31349296 ACAGGGAGGGAGGGGGCGGCGGG + Exonic
1165058549 19:33194215-33194237 GCTGGGCGGGCGGAGGCGGCTGG - Intronic
1165889170 19:39100355-39100377 GGACTGAGGGTGGTGGCGGTGGG + Intronic
1165928696 19:39342684-39342706 GAACCGCGGGCGGCGGCGGCGGG + Intronic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166534741 19:43565687-43565709 GCACCGTGGGAGGTGGAGGCGGG + Intronic
1166807281 19:45494815-45494837 GCCCTGGGGGCGGGGGCGGCGGG + Exonic
1167073420 19:47233929-47233951 GCACTGAGGGAGGCGGAGGCAGG - Intergenic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167638633 19:50668527-50668549 CCACGGCGGGCGGCGGCTGCGGG + Exonic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1168098418 19:54128417-54128439 AGGCAGAGGGCGGTGGCGGCTGG - Intronic
1168315343 19:55482510-55482532 GGGCGGACGGGGGTGGCGGCGGG - Exonic
925141320 2:1551435-1551457 ACACGGAGGGCGGTGGGTGGGGG - Intergenic
925461480 2:4067156-4067178 GCAGGGAGGGTGGGGGGGGCGGG + Intergenic
925609790 2:5693143-5693165 GCGCGGCCGGCGGCGGCGGCGGG + Exonic
925959776 2:9003810-9003832 GCAGGGCGGTCGGGGGCGGCGGG - Exonic
926077212 2:9951321-9951343 GCGGGGACGGCGGGGGCGGCGGG + Intergenic
926289486 2:11517179-11517201 GCAGGGAGGCCGGGGGCAGCAGG - Intergenic
927935284 2:27072464-27072486 GAACGAAGAGCGGTGGCTGCGGG + Intergenic
928313728 2:30231090-30231112 GGAAGGAGGGCGCTGGCGCCGGG + Intergenic
929011222 2:37447258-37447280 GGGCGGCGGGCGGTGGCGGGGGG + Intergenic
930651751 2:53970829-53970851 GCCCGGAGAGGGGTGGGGGCCGG - Exonic
931705023 2:64940120-64940142 GCACGCAGGGAGGTTGAGGCGGG - Intergenic
933772610 2:85753836-85753858 GCTGGGGAGGCGGTGGCGGCGGG + Intronic
933902902 2:86861988-86862010 GGACCGGGCGCGGTGGCGGCGGG + Intergenic
934304575 2:91810361-91810383 GCACGGTGGGCGGGGGGGGGGGG - Intergenic
934328682 2:92042389-92042411 GCACGGTGGGCGGGGGGGGGGGG + Intergenic
934856481 2:97733232-97733254 GGGCGGTGGGCGGGGGCGGCAGG + Intronic
937208609 2:120252947-120252969 GTGCGGACGGCGGAGGCGGCGGG + Exonic
937222515 2:120349903-120349925 GCACGGAGGGCAGTCCCGGGTGG + Exonic
937851396 2:126639440-126639462 GCACAGAGGGAGGTTGGGGCAGG - Intergenic
938271891 2:129979847-129979869 GGAAGGAGGGCGGTGTCGGCAGG - Exonic
938444110 2:131363953-131363975 GGAAGGAGGGCGGTGTCGGCAGG + Intergenic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942044967 2:172094892-172094914 GCGGGGAGCGCGGTGGCGCCCGG + Intergenic
942278736 2:174340969-174340991 GCCTGGAGGTCGGTGGGGGCGGG + Intergenic
943089201 2:183353772-183353794 GCACGGGGGGCTGGGGAGGCAGG + Intergenic
943645953 2:190408281-190408303 CCACGGAGGACGGAGGCGGAGGG - Intergenic
944264038 2:197705263-197705285 GCGGGGAGGGCGGTGAGGGCCGG + Intronic
948505836 2:238426649-238426671 GCCCCGAGGGCCGTGGCGGGCGG - Intergenic
948645321 2:239400691-239400713 CCGCGGCGGGCGGCGGCGGCCGG + Exonic
948875577 2:240825636-240825658 GCAGAGAGGGCAGTGGCGGGTGG - Intergenic
949014468 2:241701787-241701809 GCACGCCGGGCGGTGGGGCCGGG + Intergenic
1168976826 20:1973020-1973042 GCAGGGAGGGCTTTGGTGGCTGG - Intergenic
1170617821 20:17968527-17968549 GCAGGGAGGCCGGCGGAGGCGGG - Intronic
1170859506 20:20089751-20089773 GCACAGGGGGCGGTGGCAGGTGG - Intronic
1171012021 20:21514025-21514047 GCTCGGCGCGCGGTGGCGGCTGG + Exonic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1172091272 20:32434649-32434671 GCCCGGGTGGAGGTGGCGGCGGG + Exonic
1172091747 20:32437599-32437621 GCACGGAGTGGGGTTGCGGGGGG + Exonic
1172890556 20:38260861-38260883 GAAGGGGGGGCGGTGGGGGCGGG - Intronic
1172999744 20:39097145-39097167 GCAGGGAGGGAGGGGGAGGCAGG + Intergenic
1173569186 20:44065918-44065940 GGAAGGAGGGTGGCGGCGGCGGG - Exonic
1174287262 20:49482488-49482510 GCAGGGGGGGCGGGGGCGGCCGG - Exonic
1174607122 20:51768741-51768763 GCACGGCGGGCGTGGGCGGGGGG - Intergenic
1175210446 20:57350870-57350892 GGACGGGGGGCGGGGGGGGCGGG + Intergenic
1175429816 20:58892583-58892605 GGAGGGAGGGCGGTTGCCGCTGG + Intronic
1176024978 20:62981311-62981333 GGGTGGCGGGCGGTGGCGGCAGG + Intergenic
1176159903 20:63642589-63642611 GCAGGGTGTGCAGTGGCGGCAGG - Intronic
1176194364 20:63830730-63830752 GGAGGGAGCGCGGCGGCGGCGGG + Intronic
1177431696 21:20998284-20998306 GCGGGGAGGGCGGCGGGGGCGGG - Intergenic
1178487340 21:33027457-33027479 GCCGGGTGCGCGGTGGCGGCGGG - Exonic
1181490259 22:23257017-23257039 GCAGGGAGGGCCATGGAGGCAGG - Intronic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182000074 22:26913103-26913125 GCAGAGAGGGCAGAGGCGGCGGG + Intergenic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1183043055 22:35197893-35197915 GGAGGGAGGGCGGTGGAGGTGGG - Intergenic
1183427098 22:37746001-37746023 GAAGGGAGGGCGGTGGCGGCCGG - Intronic
1183586374 22:38755531-38755553 GCCGGGAGGGCGGTGTCTGCGGG - Intronic
1183708215 22:39487820-39487842 GCACGGGGGGCCGAGGCGCCCGG + Exonic
1184130266 22:42513266-42513288 GCAGGGATGGGGGTGGGGGCGGG - Intronic
1184140444 22:42575094-42575116 GCAGGGATGGGGGTGGGGGCGGG - Intergenic
1184250196 22:43255768-43255790 GCAGCGAGGGCGGGGGCGGGGGG + Intronic
1184723676 22:46330618-46330640 GCAGCGAGGAGGGTGGCGGCGGG - Exonic
1184791555 22:46703440-46703462 GCACGGCCGGTGGTGGCAGCAGG - Intronic
1185258609 22:49849581-49849603 GCAGGGAGGGAGGGGACGGCCGG + Intergenic
1185278856 22:49961379-49961401 GCACGGGCGGCGGCGGCGGCGGG + Intronic
1185294419 22:50046254-50046276 GCACCGAGGGCGGTGGGCACTGG + Intronic
1185421221 22:50735408-50735430 TCACGGAGGGTGGTGGGGACAGG + Intergenic
949414241 3:3799301-3799323 GCGCCGAGGGCGGGGGCGGGAGG + Intronic
950544157 3:13629055-13629077 GCTGGCAGGGCGGAGGCGGCTGG - Intronic
950572279 3:13808865-13808887 GCACGGAGGGCACAGGTGGCAGG - Intergenic
950940157 3:16884310-16884332 CCACGGCGGGCAGGGGCGGCCGG - Intronic
953406980 3:42664511-42664533 GCAGGTGGGGCGGGGGCGGCAGG - Exonic
953561426 3:43996034-43996056 GCACGGAAGGATGTGGCCGCGGG + Intergenic
953891637 3:46755779-46755801 GGAGGGAGGGAGGTGGCTGCTGG - Intronic
955386579 3:58485667-58485689 GTAGGGATGGCGGTGGGGGCGGG + Intergenic
955407651 3:58635634-58635656 GGCCGGTGGGCGGGGGCGGCCGG - Intronic
956468601 3:69542480-69542502 GCACGGCGAGCGGCGGTGGCGGG - Intronic
961330327 3:126134556-126134578 GCAGGGAGGGCTGTGGGGGTCGG - Intronic
961521070 3:127467588-127467610 GCAATGGGGGCGGTGGCAGCTGG + Intergenic
962166570 3:133055539-133055561 GCACGGGGGGTGGTGGAGGCAGG + Intronic
963172652 3:142266619-142266641 GCACTGTGGGAGGTGGAGGCAGG + Intergenic
964092063 3:152889026-152889048 GCAGGGAGGGGGCTGGAGGCGGG + Intergenic
966711913 3:182980405-182980427 GGACGGAGGGCGGCCGGGGCGGG + Intronic
966874660 3:184315135-184315157 GCCCGGAGGGCGGGCGGGGCCGG - Intronic
966878939 3:184338851-184338873 GCACGGATGGCGGCGGCTGAGGG + Intronic
968443404 4:636035-636057 GCACAGAGGCGGGTGGTGGCAGG + Intronic
968616282 4:1579171-1579193 GCAGGGAGGGCAGGGGGGGCAGG - Intergenic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968923494 4:3534832-3534854 GCATGGCGGGTGCTGGCGGCAGG - Intergenic
969652016 4:8473645-8473667 GTAAGGAGGGAGGAGGCGGCAGG + Intronic
973820552 4:54658401-54658423 GCGCGGGGGGCGGAGGCGGGGGG + Intronic
974795662 4:66746108-66746130 GCACTTAGGGAGGTGGAGGCAGG + Intergenic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
976800796 4:88989353-88989375 GCACTTAGGGAGGTCGCGGCAGG + Intronic
978912647 4:114082661-114082683 GCACTGAGGGAGGTGGCGGAGGG - Intergenic
979547116 4:121951414-121951436 CCTCGGAGGGCGGTGCCGGGCGG - Intronic
983198422 4:164834254-164834276 GCACGTTGGGAGGTGGAGGCAGG + Intergenic
985660853 5:1155904-1155926 GCGGGGAGGGCGGGGCCGGCGGG + Intergenic
985888862 5:2700420-2700442 GCCCGAAGGGCGGTGGCCACAGG - Intergenic
985963808 5:3324651-3324673 GCAGGAAGGGCGGTGGCCGAGGG - Intergenic
990382824 5:55233056-55233078 GCTCGGAGGGCCGAGCCGGCAGG + Intronic
990456712 5:55995346-55995368 GAAGGGAGGGCGGGGGCAGCGGG - Intergenic
992636839 5:78732889-78732911 GCACTTTGGGCGGTGGAGGCGGG - Intronic
997352239 5:133239224-133239246 GCAGGGAGGGGGGTGGGGGTGGG - Intronic
997804654 5:136905220-136905242 GCACTCAGGGAGGTGGAGGCAGG - Intergenic
1001045558 5:168368837-168368859 GCATGGAGGGTGGTGGCGGGTGG + Intronic
1002001282 5:176197581-176197603 GCACAGAGGGAGGTGGGGGGAGG - Intergenic
1002064955 5:176647370-176647392 GGACTGAGGGCTGTGGGGGCGGG + Exonic
1002253057 5:177941388-177941410 GCACAGAGGGAGGTGGGGGGAGG + Intergenic
1002368530 5:178730945-178730967 GGAGGGAGGGCGTGGGCGGCAGG + Intergenic
1002415971 5:179121251-179121273 GCAGCGACGGCGGTGGCAGCCGG + Intronic
1002646511 5:180659184-180659206 GCGGGGTGGGGGGTGGCGGCGGG - Intergenic
1003051530 6:2785105-2785127 GCACGGGGGGCAGTGGCCCCTGG - Exonic
1004123148 6:12845432-12845454 GCACGGAGGGCGGGGGGGGGGGG - Intronic
1004622644 6:17344491-17344513 GCATGGAGGTAGGTGGCTGCTGG + Intergenic
1004686909 6:17955074-17955096 GCACTTTGGGAGGTGGCGGCAGG - Intronic
1004924391 6:20403451-20403473 CGACGGAGGGCGGGGGCAGCTGG + Intronic
1006103744 6:31703322-31703344 GCAGGGAGGGCGGGGCCGGCAGG - Exonic
1006137048 6:31901739-31901761 GCACGGTGCGTGCTGGCGGCGGG - Intronic
1008921976 6:56851680-56851702 GCAGGGAGGGCGGCGGTGGTTGG - Intronic
1011470376 6:87701990-87702012 GAGCGGACGGCGGGGGCGGCCGG - Exonic
1011643221 6:89433699-89433721 GAAGGAAGGGCGGTGGGGGCGGG + Intronic
1013272686 6:108558635-108558657 GCCCGGAGCCCGGAGGCGGCTGG + Intergenic
1013293304 6:108736947-108736969 GCAGGGAGAGGGGTGGGGGCCGG + Intergenic
1014137743 6:117907923-117907945 GCGCGGGGGGCGGGGGCTGCGGG + Intronic
1014724951 6:124962561-124962583 GCACGGTGAGCGGCGGCGGCGGG + Exonic
1015496868 6:133891613-133891635 GGAAGGGGGGCGGTGGGGGCAGG - Intronic
1015965716 6:138693479-138693501 GCCGGGAGGGCGGAGGCGCCAGG + Intergenic
1017719729 6:157236144-157236166 GCAGGGCGGGCGGTGACGGCCGG + Intergenic
1017907559 6:158767425-158767447 ACACGGGGGGTGGTGGGGGCGGG + Exonic
1019058727 6:169241037-169241059 GCAGGGAGGGCGGCGAGGGCAGG - Intronic
1019058739 6:169241068-169241090 GCAGGGAGGGCGGCAGGGGCAGG - Intronic
1019531302 7:1504699-1504721 TCCCGGAGAGCGGGGGCGGCCGG + Intergenic
1019708987 7:2509819-2509841 GCAGGGAGTGGGGTGGAGGCTGG + Intergenic
1020139269 7:5603805-5603827 GCAGGGAGTGGGGTGGAGGCTGG - Intronic
1022732950 7:33048289-33048311 GCACGTTGGGAGGTGGAGGCAGG - Intronic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1023638778 7:42237871-42237893 GCGAGGCGGGCGGCGGCGGCTGG + Intergenic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1024062017 7:45704936-45704958 GCAGGGAGGAAGGTGGGGGCTGG - Intronic
1025829786 7:65038705-65038727 GCCGGGTGGGGGGTGGCGGCGGG + Intergenic
1026412007 7:70132959-70132981 GCATGGAGGGCTGTGGGTGCTGG + Intronic
1026729095 7:72895671-72895693 GCACTGTGGGAGGTGGAGGCAGG + Intronic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1027114911 7:75471442-75471464 GCACTGTGGGAGGTGGAGGCAGG - Intronic
1028831753 7:95335887-95335909 GCAGGGAGGCCTGTGGCTGCAGG + Intergenic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029713152 7:102310735-102310757 GTCCGGAGGGCGGTGGAGGAGGG - Intronic
1030055841 7:105583161-105583183 GCGCTGAGGGCGGGGGCGGCGGG + Intronic
1030115260 7:106058060-106058082 GCAGGGGGCGCGGTGGGGGCAGG + Intergenic
1031834687 7:126668516-126668538 GCAGGGATGGGGGTGGCGGTGGG - Intronic
1032087237 7:128890730-128890752 GGATGGAGGGCCGTGCCGGCTGG + Intronic
1032511160 7:132473391-132473413 CCCAGGAGGGCAGTGGCGGCAGG + Intronic
1033278563 7:139990258-139990280 GCACAGCTGGCGGTGGTGGCTGG + Intronic
1033535488 7:142308293-142308315 GCAGGGAGGGAGGGGGCTGCTGG + Intergenic
1034441059 7:151086354-151086376 GCAGGAGGGGCGGGGGCGGCGGG + Intronic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034622077 7:152464039-152464061 ACCCGGAAGGCGGTGGGGGCGGG + Intergenic
1034781496 7:153886552-153886574 GCCCGGAGGGAAGTGGAGGCCGG + Intergenic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1035281209 7:157779547-157779569 CGACGGAGGGTGGGGGCGGCAGG + Intronic
1035469424 7:159100136-159100158 TCAGGGAGGGCGGTGGGGCCAGG + Intronic
1035533945 8:376970-376992 GTCCGGAGGGCGGGGGCTGCGGG + Intergenic
1035744381 8:1951054-1951076 ACACGGAGGGCCGGGGAGGCCGG + Intronic
1036203661 8:6789909-6789931 AGGCGGAGGGTGGTGGCGGCGGG + Intergenic
1036561929 8:9905664-9905686 GCACTGCTGGCGGCGGCGGCCGG + Intergenic
1036664734 8:10730865-10730887 GCAGGGAGGGCGGTGGAGTCTGG - Intronic
1038277520 8:26134321-26134343 GCAGGGAGGGCAGTGGCTGATGG - Intergenic
1038841050 8:31185238-31185260 ACAAGGAGGACGGTGGCTGCTGG + Intergenic
1039702708 8:39978535-39978557 GCATGGAGGGCGGGGGTGGAGGG + Intronic
1040915882 8:52565731-52565753 GCTCGGGGGGTGGAGGCGGCGGG - Intergenic
1041689892 8:60678672-60678694 GCCCGGAGGGAGCTGGCGGCGGG + Intergenic
1042190046 8:66177315-66177337 GCTCGGACTGCGGCGGCGGCTGG + Exonic
1042591750 8:70403601-70403623 GCAGGAAGGGCAGTCGCGGCCGG + Intronic
1043384738 8:79737277-79737299 GCAGGGAGGGAAGTGGAGGCGGG + Intergenic
1043463953 8:80486951-80486973 GCGCGGGCGGCGCTGGCGGCGGG - Exonic
1045305371 8:100952582-100952604 GCACGGAGGGTGGGGCGGGCCGG - Intronic
1045425484 8:102061735-102061757 GTATGGAGGTCTGTGGCGGCTGG - Intronic
1045489072 8:102655696-102655718 GCGCTGAGCGCGGCGGCGGCGGG - Exonic
1046131901 8:109975779-109975801 GCCCGGAGGGAGGTGGAGGCGGG - Exonic
1046547432 8:115669110-115669132 TCCCGGCGGGCGGCGGCGGCGGG - Intronic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049406269 8:142453008-142453030 GGCGGGAGGGAGGTGGCGGCCGG - Intronic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049537404 8:143188766-143188788 GCAAGGAGGGCAGGGCCGGCTGG + Intergenic
1049558540 8:143296013-143296035 GCGCAGAGGGCGGGGGCAGCTGG + Exonic
1049778073 8:144415539-144415561 GCAGGGAGGGCTGTGGCTCCAGG - Intronic
1049791035 8:144472833-144472855 GCACGGAAGGCAGGGGCGGCCGG + Exonic
1050090838 9:2015861-2015883 GCGGGGAGGGGGGTGGCCGCAGG + Intronic
1053799203 9:41753856-41753878 GCATGGGGGGTGCTGGCGGCAGG - Intergenic
1054146009 9:61561143-61561165 GCATGGGGGGTGCTGGCGGCAGG + Intergenic
1056005072 9:82260881-82260903 GCAGGGAAGGCGGTGGGGGTTGG + Intergenic
1056143508 9:83707456-83707478 GCCGGGATGGGGGTGGCGGCAGG - Intronic
1056245460 9:84690568-84690590 GCATGGTGGCCGGTGGTGGCAGG + Intronic
1056623857 9:88237737-88237759 CCAGGGAGGGAGGTGGCTGCTGG - Intergenic
1056803026 9:89707185-89707207 GCACAGAGGGAGGTGAGGGCTGG + Intergenic
1056992561 9:91424426-91424448 GGAAGGCGGGGGGTGGCGGCTGG + Intergenic
1059435041 9:114270940-114270962 GCAGGGTGGGAGGTGGCTGCTGG - Intronic
1060116143 9:120942527-120942549 GGAAGGAGGGAGGTGGCGGAGGG + Intergenic
1060266377 9:122113840-122113862 GCAGGGAGGGAGGGGGCGCCTGG + Intergenic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061163794 9:128911056-128911078 GCACGGAGGGAGGTGGCCCCTGG + Intronic
1061163808 9:128911108-128911130 GCACGGAGGGAGGTGGCCCCTGG + Intronic
1061580282 9:131531767-131531789 GCACGGAGCGGGGGGGCGGCAGG - Intergenic
1062324147 9:136004427-136004449 GGAAGGAGGGCGGGGGCAGCAGG - Intergenic
1062384002 9:136301484-136301506 AGACGGAGGGTGGTGGCTGCAGG + Intronic
1062410027 9:136418928-136418950 GCACTGAGGACGGTGGCAGGCGG - Intronic
1062586586 9:137252431-137252453 CTACAGAGGGCGGTGGCCGCAGG + Exonic
1203772757 EBV:57932-57954 GGACAGAGGGAGGCGGCGGCCGG + Intergenic
1185747377 X:2583895-2583917 GCAGGGCGGGCGGTGGGGCCCGG + Intergenic
1186489244 X:9958605-9958627 GCAGGGAGTGGGGTGTCGGCGGG - Intergenic
1186747144 X:12581878-12581900 GCAGGGTGGGAGGTGGAGGCAGG - Intronic
1187225833 X:17375112-17375134 GGACGCAGGGCGGGGGAGGCCGG - Intergenic
1187281437 X:17860926-17860948 GCCCGGAGGCCGGGGCCGGCTGG - Intronic
1189990259 X:46587257-46587279 CCACGGTGGGAGGTGACGGCGGG + Intronic
1190385522 X:49879591-49879613 GCGGGGAAGGCGGAGGCGGCGGG + Intergenic
1195108654 X:101623916-101623938 GGAGGGACGGGGGTGGCGGCGGG + Intronic
1197776487 X:130121616-130121638 GCTGGGAGGGCGGTGGCGCGTGG + Intergenic
1198807193 X:140504172-140504194 GCAGCGCGGGCGGCGGCGGCGGG + Exonic
1199438303 X:147839585-147839607 GCACTCAGGGTGGTGGGGGCTGG + Intergenic
1200044802 X:153395812-153395834 GGAAGGAGGGAGGTGGCAGCGGG - Intergenic