ID: 968726590

View in Genome Browser
Species Human (GRCh38)
Location 4:2250747-2250769
Sequence CAGAAAAGGGAGAAATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1282
Summary {0: 1, 1: 1, 2: 8, 3: 84, 4: 1188}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968726590_968726596 -6 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726596 4:2250764-2250786 TTTCTGGAAGCAGAAGCTCTAGG 0: 1
1: 0
2: 4
3: 41
4: 392
968726590_968726599 2 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726599 4:2250772-2250794 AGCAGAAGCTCTAGGCAGAGGGG 0: 1
1: 0
2: 1
3: 40
4: 307
968726590_968726600 13 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726600 4:2250783-2250805 TAGGCAGAGGGGCAGAAGTGCGG 0: 1
1: 1
2: 6
3: 70
4: 566
968726590_968726602 17 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726602 4:2250787-2250809 CAGAGGGGCAGAAGTGCGGAGGG 0: 1
1: 0
2: 2
3: 31
4: 449
968726590_968726598 1 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726598 4:2250771-2250793 AAGCAGAAGCTCTAGGCAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 324
968726590_968726601 16 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726601 4:2250786-2250808 GCAGAGGGGCAGAAGTGCGGAGG 0: 1
1: 0
2: 2
3: 42
4: 382
968726590_968726604 28 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726604 4:2250798-2250820 AAGTGCGGAGGGCGCTGTCTGGG 0: 1
1: 0
2: 1
3: 3
4: 95
968726590_968726603 27 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726603 4:2250797-2250819 GAAGTGCGGAGGGCGCTGTCTGG 0: 1
1: 0
2: 2
3: 10
4: 187
968726590_968726597 0 Left 968726590 4:2250747-2250769 CCAGCCCATTTCTCCCTTTTCTG 0: 1
1: 1
2: 8
3: 84
4: 1188
Right 968726597 4:2250770-2250792 GAAGCAGAAGCTCTAGGCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968726590 Original CRISPR CAGAAAAGGGAGAAATGGGC TGG (reversed) Intronic
900264933 1:1752685-1752707 AAGAAGCGTGAGAAATGGGCTGG - Exonic
900340061 1:2184122-2184144 CTGGATAGGCAGAAATGGGCCGG + Intronic
900420602 1:2554438-2554460 CAGAGAAGGGAGAAAAGGGACGG + Intergenic
900423568 1:2566237-2566259 CAGAAAAGGGAGAAAAGGGGTGG - Intergenic
900424972 1:2573194-2573216 CACACAAAAGAGAAATGGGCTGG + Intergenic
901201640 1:7470589-7470611 TAGGAAAGGGAGTGATGGGCTGG + Intronic
901464286 1:9411326-9411348 AAGAAAAGAGAGAGGTGGGCAGG - Intergenic
901961241 1:12828260-12828282 ATGAAAAGTGAGAACTGGGCCGG - Intronic
901967834 1:12882865-12882887 ATGAAAAGTGAGAACTGGGCCGG - Intronic
901975638 1:12941995-12942017 ATGAAAAGTGAGAACTGGGCCGG - Intronic
901983232 1:13053130-13053152 ATGAAAAGTGAGAACTGGGCCGG - Intronic
901985779 1:13074202-13074224 ATGAAAAGTGAGAACTGGGCCGG + Intronic
901996030 1:13152565-13152587 ATGAAAAGTGAGAACTGGGCCGG - Intergenic
901998857 1:13175788-13175810 ATGAAAAGTGAGAACTGGGCCGG + Intergenic
902009536 1:13259770-13259792 ATGAAAAGTGAGAACTGGGCCGG + Intronic
902017342 1:13318915-13318937 ATGAAAAGTGAGAACTGGGCCGG + Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902764828 1:18607129-18607151 GAGCAAAGGGACAAAGGGGCTGG + Intergenic
903171178 1:21555064-21555086 CAGCCAAGGGAGATATGGGTGGG + Intronic
903425075 1:23247365-23247387 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
903712468 1:25336591-25336613 CAGAAAAGAGAAAAAAGGGTAGG + Intronic
904008685 1:27377715-27377737 CAGAAGAGTGAGAACTGGGCTGG - Intergenic
904212392 1:28894623-28894645 CAGAAATGGGAGGGATGGGGAGG + Intronic
904221064 1:28969379-28969401 AAGAAAAGTAAGACATGGGCTGG - Intronic
904681880 1:32234910-32234932 GAGAATAGGGTGAGATGGGCAGG - Intergenic
904910658 1:33931860-33931882 CAGTACAGGTAGGAATGGGCTGG + Intronic
904966176 1:34375749-34375771 GAGAAAAGGGAGTAATAGGAGGG - Intergenic
905287936 1:36896563-36896585 CATGAAAGGCAGAAAAGGGCTGG + Intronic
905332269 1:37213489-37213511 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
905332414 1:37214611-37214633 CAGCAAAGGGAGATAGGGGTAGG - Intergenic
905505198 1:38473768-38473790 GAGGATAGGGAGAAATGGGAAGG + Intergenic
906049245 1:42857024-42857046 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
906080750 1:43086654-43086676 CAGAAAAGGGGGAAAGGGGTCGG - Intergenic
906744695 1:48213568-48213590 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
906811745 1:48834096-48834118 CCAAAAAGGGAGAAATCGGAAGG - Intronic
907096404 1:51785195-51785217 CAGAAAAGGGAGACATGACCAGG - Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907503735 1:54902414-54902436 CAGAAAAGTGGGAAAGGGGTAGG + Intergenic
907596633 1:55726315-55726337 TAGAAAATGGGGAAATGGGGGGG + Intergenic
907683166 1:56583332-56583354 GAGAAAAGGCAGGAAGGGGCAGG + Intronic
907730533 1:57061306-57061328 ACGAAAAGGGAGAAGGGGGCAGG + Intronic
908120638 1:60983173-60983195 CATATCAGGGAGAAATGGGGAGG + Intronic
908132211 1:61083899-61083921 TAGACAAGGGAGGAATGGACAGG - Intronic
908378572 1:63572801-63572823 CAGCAAAGGGAGATAGGGGTGGG + Intronic
908394027 1:63708687-63708709 CAGAAAAGGGTGAAATGAAATGG + Intergenic
908669622 1:66532749-66532771 CAGCGAAGGAAGAAAAGGGCAGG - Intergenic
909015332 1:70373900-70373922 CAGAGAAGGGAGATAGGGGTGGG - Intronic
909035147 1:70588672-70588694 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909291292 1:73886975-73886997 CAGGAAAGCCAGAAATGGACTGG + Intergenic
909527645 1:76644696-76644718 TCCAAAAGGGAGAAATGGGCCGG + Intergenic
909588391 1:77317511-77317533 CAGCAAAGTGAAAAATGGGCAGG - Intronic
909788429 1:79643298-79643320 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
909817637 1:80016304-80016326 CATAAAAAGCAGAGATGGGCCGG - Intergenic
910003059 1:82360261-82360283 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
910049209 1:82956483-82956505 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
910687085 1:89928461-89928483 AAGAAAAAAGAAAAATGGGCTGG + Intronic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
910799324 1:91130059-91130081 CAGACAAGGGAGAAAAGGAAGGG - Intergenic
910803283 1:91165876-91165898 CAGACAGGTAAGAAATGGGCTGG + Intergenic
910872526 1:91847913-91847935 CATAAAAGGAAGAAATGGTGGGG + Intronic
911004453 1:93203953-93203975 CTGAAATGGGAGAAATGGAAAGG + Intronic
911282143 1:95942865-95942887 TGGCAAAGGGAGAGATGGGCTGG - Intergenic
911510113 1:98801154-98801176 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
911510903 1:98806514-98806536 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
911817841 1:102376346-102376368 CAGAAATGGGAAGAATTGGCAGG - Intergenic
911971810 1:104448343-104448365 GAGAAAAGGAAGAAAAGGGGAGG - Intergenic
912009819 1:104946383-104946405 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
912296310 1:108474123-108474145 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
912337217 1:108874504-108874526 GAGAGAAGAGAGAAATTGGCAGG + Intronic
912421593 1:109545754-109545776 CATCAAAAGGGGAAATGGGCTGG + Exonic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
912815606 1:112825762-112825784 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
913025927 1:114840348-114840370 GAGAGAAGGAAGAAATGGCCAGG - Intergenic
913237149 1:116795187-116795209 TAGAAATGGTAGAAAGGGGCAGG + Intergenic
914455687 1:147834171-147834193 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914868499 1:151453214-151453236 GCGAAAAGGGAGAAAGAGGCTGG - Intronic
914893415 1:151648713-151648735 CAGAAATGGTAAATATGGGCTGG - Intronic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916866540 1:168865766-168865788 CAGCAAAGGGAGATAGGGGTAGG + Intergenic
917106710 1:171499492-171499514 TAGAAAAGGGAGAGATGGGCCGG + Intronic
917288637 1:173448516-173448538 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
917535640 1:175872452-175872474 GAGAAAAGGGAGTGATGGGGAGG + Intergenic
918287148 1:183068643-183068665 TAGAAAAGTGACACATGGGCTGG + Intronic
918567178 1:185948380-185948402 CAGCAAAGGGAGATAGGGGTGGG + Intronic
918568043 1:185953865-185953887 CAGCAAAGGGAGATAGGGGTGGG + Intronic
918950189 1:191126379-191126401 CTGAGAAGGGTGAAATGGGCAGG + Intergenic
919091194 1:192980276-192980298 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919624345 1:199896552-199896574 CACAAAAGGGAGGAAAAGGCTGG - Intergenic
919747268 1:201016747-201016769 CAGGAGAGGGACAAATGGGAGGG - Intronic
920087355 1:203427305-203427327 CAGAAAAGGGAGAGATGTAGGGG - Intergenic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920209766 1:204319831-204319853 GAGAGAAGGGAGAAAGGGACAGG + Intronic
920418973 1:205817505-205817527 CAGCAAGGGGAAAAATGGGAGGG - Intergenic
921095930 1:211887308-211887330 TAGAAAAGGGAGAACTGGCCAGG - Intergenic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
921450695 1:215302348-215302370 TAAAAAAGGAAGAAATGGGGGGG + Intergenic
921643847 1:217589247-217589269 CAGAAAAGGGAGGGATGGGCGGG - Intronic
922598707 1:226833818-226833840 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
922599408 1:226838280-226838302 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
922934653 1:229413555-229413577 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923464758 1:234238369-234238391 CAGCAAAGGAAGAAATGAGATGG + Intronic
923779251 1:237007601-237007623 CAGGAAAGGGAGAAATGCCGTGG + Intergenic
923956759 1:239031139-239031161 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
923962623 1:239102498-239102520 CAGAAAAGCGAGAAAGGGGTCGG - Intergenic
923963266 1:239106941-239106963 CAGCAAAGGGAGATAGGGGCGGG - Intergenic
924180486 1:241435131-241435153 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
924181170 1:241439761-241439783 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
924258999 1:242210746-242210768 CAGCAAAGGGAGATAGGGGTGGG - Intronic
924263033 1:242251612-242251634 CTGAACATGGAGAAAAGGGCAGG + Intronic
924743719 1:246813485-246813507 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924838608 1:247682378-247682400 CCCAAATGGGAAAAATGGGCAGG - Intergenic
924896345 1:248340797-248340819 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1063352985 10:5373686-5373708 CAGAAAAGAGGGATGTGGGCAGG - Intronic
1063361311 10:5461543-5461565 CAGAAAAAGGAGAGATGGAGGGG + Intergenic
1063459487 10:6206394-6206416 TAGAAAGGGGGGAAAGGGGCGGG - Intronic
1063641676 10:7836568-7836590 AAGAAAATGTGGAAATGGGCCGG - Intronic
1063954602 10:11254884-11254906 CAGGAAGGGGAGAGATGGGATGG - Intronic
1064214309 10:13386806-13386828 CAGAAATGAGAAAATTGGGCCGG + Intergenic
1064379409 10:14827594-14827616 AAGAAAACGTAGAATTGGGCTGG + Intronic
1064636845 10:17377277-17377299 CAGCAAAGGGAGAGAGGGGTGGG - Intronic
1064637591 10:17385480-17385502 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1064666572 10:17658514-17658536 CAAAAAAAGAAGAAATGGACAGG - Intronic
1064756966 10:18580278-18580300 TGGAAAAGGGAGAAAAGAGCGGG - Intronic
1064794840 10:18999740-18999762 TAGAGAAGGGGGAAATGGGGAGG - Intergenic
1064887161 10:20123716-20123738 CAGAAAAGTGGGAAAGGGGATGG + Intronic
1064890116 10:20161733-20161755 CAGAAAAGGTAGAATGCGGCTGG + Intronic
1065437464 10:25717565-25717587 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
1065752858 10:28903898-28903920 CAGAAAAGTAAGCAAAGGGCAGG + Intergenic
1065918525 10:30371512-30371534 CAGAACAGAGAGACCTGGGCTGG + Intronic
1066497545 10:35956788-35956810 CAGAAGAGGGAGAAAGGGAGGGG - Intergenic
1066680872 10:37936241-37936263 CAGAAAAGGCAGGACTGGGATGG - Intergenic
1066721752 10:38346837-38346859 CCGAACATGGAGAAAAGGGCAGG - Intergenic
1066951405 10:42121733-42121755 GAGAAAAGGAAGAAAAGGGAGGG - Intergenic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067040822 10:42952249-42952271 CAGAGAAGGTAGAACTGGCCGGG - Intergenic
1067096090 10:43301191-43301213 CAAAAAAGGGAGAGATGTGGGGG - Intergenic
1067360060 10:45571448-45571470 CAGCAAAGGGAGAAAGGGTGGGG - Intronic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1067902348 10:50255320-50255342 AGGCAAAGGGAGAAATGGCCAGG + Intergenic
1068054757 10:51997834-51997856 AAGAAAAGAGAGAGATGGGGAGG - Intronic
1068121014 10:52781977-52781999 CAGCAAAGGGAAAAAGGTGCAGG + Intergenic
1068178500 10:53492824-53492846 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1068533427 10:58213707-58213729 AAGAAAAAATAGAAATGGGCTGG + Intronic
1068591853 10:58861096-58861118 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1068592739 10:58866982-58867004 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1068624223 10:59223377-59223399 CAAGAAAGGTAGAAATAGGCTGG - Intronic
1068936377 10:62639324-62639346 CAGAACTGGGACAAATGGGTAGG + Intronic
1069239938 10:66126970-66126992 TAGAAAAGGGGGAAAATGGCCGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070168258 10:73913837-73913859 CAGATGAGGGAGAAATGAGGCGG - Intronic
1070310290 10:75268222-75268244 CTGGGAAGGGAGAAATGAGCGGG - Intergenic
1070609180 10:77921884-77921906 CAGAAATGGCAGAACTTGGCTGG - Intronic
1070869509 10:79738160-79738182 CAGAAAAGGGAGTCAAGGGTGGG + Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071187797 10:83063241-83063263 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1071299561 10:84246047-84246069 CAGGAAAGGGAGACACGGGCTGG - Intronic
1071385727 10:85119317-85119339 CAAAAAGGAGAGAAGTGGGCTGG - Intergenic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1071551700 10:86571042-86571064 TAGATAAGAGACAAATGGGCCGG - Intergenic
1071636429 10:87260367-87260389 CAGAAAAGGGAGTCAAGGGTGGG + Intergenic
1071658815 10:87477578-87477600 CAGAAAAGGGAGTCAAGGGTGGG - Intergenic
1071916693 10:90300603-90300625 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1071960762 10:90807616-90807638 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1071960953 10:90808606-90808628 CAGAAAAGTGGGAAAGGGGTCGG - Intronic
1071961614 10:90813137-90813159 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1072327950 10:94316710-94316732 CAGAAGAGGGATACATGGGCAGG + Exonic
1073063434 10:100745358-100745380 CAGGGGAGGGAGAAATGGGAGGG - Intronic
1073246794 10:102096515-102096537 CAGAAAAGAGAGAAAGGGCCGGG - Intergenic
1073683264 10:105727879-105727901 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1074133509 10:110606957-110606979 TAGAAAAGGGAGAAATAGAAAGG + Intergenic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074495054 10:113972841-113972863 CAGCAACGAGAGAAATGTGCTGG - Intergenic
1074552194 10:114454572-114454594 CAGAAAAGAGAGCAAAGGGGTGG + Intronic
1074618274 10:115092783-115092805 GAGAAAAAGAAGAAATAGGCAGG + Intergenic
1074740605 10:116481803-116481825 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
1074911581 10:117914646-117914668 TAGAAAAGGGAGAGCTGTGCTGG + Intergenic
1075613547 10:123874157-123874179 TAGAAATGTGAGAAATAGGCTGG - Intronic
1076058674 10:127396019-127396041 AAGGAAAGGGAGAAATGAGCAGG + Intronic
1076181398 10:128411707-128411729 CAGAAAAGGCAGAAAAGGGAGGG + Intergenic
1076400351 10:130179732-130179754 CAGAAAATGGAGAACTGTGGCGG + Intronic
1076492904 10:130875660-130875682 CAGATAAGGAAGAAAGGGGGTGG - Intergenic
1076516789 10:131050179-131050201 CAGCAAAGGGAGAGAGGGGTGGG - Intergenic
1076882411 10:133245958-133245980 CAGCAAATGGAGCAATGAGCTGG - Intergenic
1077363770 11:2153100-2153122 CAGAGAAGGCAGAAATTAGCAGG - Intronic
1077397300 11:2331346-2331368 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1077532765 11:3104995-3105017 CAGAAAAGGAAGAGATGAGGGGG - Intronic
1077578033 11:3399072-3399094 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1077590042 11:3484199-3484221 CAGAAAAGCAGGAAATGGGTTGG + Intergenic
1077752903 11:4992143-4992165 AAGAGAAGGGAGATCTGGGCAGG + Intronic
1077851172 11:6075535-6075557 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1077883068 11:6366315-6366337 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1077883875 11:6371537-6371559 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1077937387 11:6802132-6802154 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1078004395 11:7521781-7521803 CAGTAAAGAGGGAAAGGGGCTGG + Intronic
1078254665 11:9647591-9647613 CAGAAAAGGAAGAAAAAAGCTGG + Intergenic
1078495999 11:11817790-11817812 CAGAAATGTGTGAGATGGGCTGG + Intergenic
1079727246 11:23891742-23891764 CAGAAAAGCGGGAAAGGGGCCGG + Intergenic
1079847092 11:25486596-25486618 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1080027423 11:27629171-27629193 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1080028263 11:27634578-27634600 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1080248633 11:30208339-30208361 AAGAAAAGGAAGGAATGGGCAGG + Intergenic
1080313901 11:30926444-30926466 CAGAAAGGTGGAAAATGGGCTGG + Intronic
1080450552 11:32375383-32375405 CAAAAAATGCAAAAATGGGCCGG + Intergenic
1080880231 11:36312897-36312919 CAGAAAAGTCAGAAAAGGGCAGG - Intronic
1080920829 11:36707892-36707914 CAGTAAAGTGAGAAATAGACTGG + Intergenic
1081191744 11:40112495-40112517 GAGAAATGGGAGAAAAGGACGGG - Intergenic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1082193874 11:49278585-49278607 CAGGAGAGAGAGATATGGGCAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083076397 11:60043198-60043220 AAGAAAAAGCATAAATGGGCCGG - Intronic
1083389064 11:62334801-62334823 CAGAAAAGGAGGGACTGGGCAGG - Intergenic
1083392540 11:62365130-62365152 CAGGAGTGGGAGAAATGGGAAGG + Intronic
1083436746 11:62648174-62648196 AAGGAAAGGGACAAATGGCCAGG + Exonic
1083543218 11:63529418-63529440 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1083746765 11:64741390-64741412 GAGAGAAGGGAGAAAGGGGAGGG + Intronic
1083755689 11:64790470-64790492 CAGAGAAGAGAGACATGGCCTGG + Intronic
1084046850 11:66573923-66573945 CAGAGAAGGGAGATAAGGGTGGG - Intergenic
1084106918 11:66986275-66986297 CAGAGAAGGGAGACATGGCCTGG - Intergenic
1084195369 11:67521525-67521547 CAGGAAAGGGACAAATGGGCCGG - Intronic
1084245757 11:67855973-67855995 CAGAAAAGCAGGAAATGGGTTGG + Intergenic
1084826928 11:71738605-71738627 CAGAAAAGCAGGAAATGGGTTGG - Intergenic
1085303272 11:75471213-75471235 CCCAAAAGGGAGAGATGGGCAGG + Intronic
1085390167 11:76178191-76178213 CAGAGAAGGGAGGACTGGCCTGG + Intergenic
1085470035 11:76752123-76752145 CAGAGAAAGGAAAAATGGGATGG - Intergenic
1085987682 11:81806445-81806467 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1085987854 11:81807360-81807382 CAGAAAAGCGGGAAAGGGGTTGG - Intergenic
1085988580 11:81812556-81812578 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1086218065 11:84407236-84407258 TTAAAAAGGGAGAAATGGGAGGG - Intronic
1086265753 11:84995852-84995874 AAGAAAAGGGACAGATGGGCAGG - Intronic
1086602839 11:88656264-88656286 GAGAAGAGGGAGAAATTGGATGG - Intronic
1087099562 11:94351299-94351321 CAGCAAAGGGAGATAAGGGTAGG - Intergenic
1087134524 11:94702704-94702726 CAGGAAAGAGAGAAAAGGGGAGG + Intergenic
1087252817 11:95923413-95923435 ATGAAAAGAGAGAAAAGGGCTGG + Intronic
1087315158 11:96593551-96593573 CAGCGAAGGGAGATAAGGGCGGG - Intergenic
1087470802 11:98571802-98571824 CAGAAAAGGCAGAACTGATCTGG - Intergenic
1087643221 11:100777884-100777906 TACAAAAGGTAGAACTGGGCGGG + Intronic
1088152329 11:106759636-106759658 TATAAAAAGGAGAAATGGCCAGG + Intronic
1088410387 11:109527484-109527506 TAGAAAAGGGAAAAATGAGATGG + Intergenic
1088572067 11:111231880-111231902 TAGAAAAGAGAGAACGGGGCAGG - Intergenic
1088811777 11:113397178-113397200 CAGGAAAGGAAGCAACGGGCTGG - Intronic
1088817333 11:113430589-113430611 GACAAAAGGGAGGGATGGGCTGG - Intronic
1088818939 11:113440746-113440768 CAGAAAGGAGAGAAATGGAGAGG + Intronic
1088829670 11:113524349-113524371 AAGAAAAGGGGGAAATGTGGGGG + Intergenic
1088851434 11:113706450-113706472 CAGGAAAGGGGGACAAGGGCTGG + Intergenic
1088912673 11:114203847-114203869 CTGAAAATGGAGGAATGGGGAGG - Intronic
1089076881 11:115745512-115745534 CTGAAAAGGGAGAAAGGCACTGG - Intergenic
1089458205 11:118637781-118637803 GAGAGATGGGAAAAATGGGCTGG - Intronic
1089953081 11:122547719-122547741 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1090850896 11:130569632-130569654 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1090851259 11:130572476-130572498 CAGAAAAGAGAGAATAGGGATGG - Intergenic
1090926459 11:131254630-131254652 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1091770047 12:3145680-3145702 CAGAAAAATGAGGAATGAGCAGG - Intronic
1092358327 12:7815448-7815470 CAGAAAAGATTGAAATGGGATGG - Intronic
1092366406 12:7880708-7880730 AAAAAAAGAGAGAAATTGGCCGG + Intronic
1092416339 12:8293103-8293125 CAGAAAAGTGGGAAACGGGTTGG + Intergenic
1092474321 12:8806092-8806114 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1092474950 12:8810457-8810479 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1092626274 12:10333077-10333099 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1092627064 12:10338292-10338314 CAGGAAAGGGAGATAAGGGTGGG + Intergenic
1092829881 12:12433478-12433500 CAAAAAAGGGAGGGATGGGTAGG + Intronic
1092925138 12:13265219-13265241 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1093071478 12:14710260-14710282 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1093287110 12:17277367-17277389 CAGAAAAGTGAGGAGTGGGGAGG + Intergenic
1093812313 12:23505931-23505953 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094050505 12:26215431-26215453 CAGAAAAGGCAGAAATGGGGTGG + Intronic
1094316388 12:29140456-29140478 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094618036 12:32053968-32053990 AAGCAAAGGAAGAAATAGGCTGG - Intergenic
1094654049 12:32403889-32403911 CATAAAAGGGAGCATTGGGCCGG - Intronic
1094723688 12:33090522-33090544 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094826611 12:34274134-34274156 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1095194776 12:39300839-39300861 AAGAAAAGAGAGAAAGGGGATGG - Intronic
1095850086 12:46792952-46792974 CAGAAAAGGCAGCAATGAGCAGG - Exonic
1096071138 12:48776152-48776174 AAGAAGAGGGACAAATGGGGAGG - Intronic
1096396075 12:51267784-51267806 GATAAAAGAGAGAAATGGCCAGG - Intronic
1096906657 12:54942640-54942662 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1096907450 12:54948079-54948101 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1096985797 12:55756167-55756189 CAGAAAAGAGGGAAAAGGGAAGG + Exonic
1097117494 12:56708438-56708460 CAAAAAAAGGAGAAAAGGCCAGG - Intergenic
1097261419 12:57722391-57722413 AAGAAAAGGGATAGAGGGGCCGG + Intergenic
1097398218 12:59101952-59101974 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1097416562 12:59323287-59323309 CAGCAAAGGGAGACAAGGGTGGG + Intergenic
1097544289 12:60979375-60979397 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1097592894 12:61592809-61592831 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1097690523 12:62730135-62730157 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1098032396 12:66268013-66268035 CAGAAAATGGAGACATGGAGGGG - Intergenic
1098173181 12:67766907-67766929 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
1098269065 12:68752707-68752729 CAAAAAATTAAGAAATGGGCAGG + Intronic
1098427347 12:70379706-70379728 CATAAAAGTGCAAAATGGGCTGG - Intronic
1099201189 12:79679057-79679079 CAGAAAAGGGGGCCATGGGCCGG - Intronic
1099291620 12:80783224-80783246 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1099292259 12:80787632-80787654 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1099292432 12:80788589-80788611 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1099319911 12:81133200-81133222 TAGAAAAGAGAAAAATGGCCAGG + Intronic
1099872552 12:88368351-88368373 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1100241760 12:92716686-92716708 CCCAAAAGGGAGAAATGTACTGG - Intergenic
1100263814 12:92957151-92957173 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1100497832 12:95142437-95142459 CAAAAAATAGAAAAATGGGCTGG - Intronic
1101023908 12:100582124-100582146 CAGCAAAGGGAGATAAGGGTGGG + Intronic
1101278747 12:103228206-103228228 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1101593430 12:106141981-106142003 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1101595759 12:106163268-106163290 CAGAAAGGAGAGAAAAGGGAAGG - Intergenic
1101926588 12:108976909-108976931 CTTAAAAGAGAGGAATGGGCTGG - Intronic
1102117068 12:110410804-110410826 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1102205013 12:111084274-111084296 CAGGAATGGGAGGAAAGGGCGGG - Intronic
1102259044 12:111432339-111432361 CAAAAAAGTTAAAAATGGGCTGG - Intronic
1102282333 12:111628185-111628207 TAGAAAAGGGAGAAAGAAGCTGG + Intergenic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102789825 12:115635886-115635908 AAGAAAGGGGAGAAAGGGGAGGG + Intergenic
1102827216 12:115958932-115958954 CAAAAAAAGGGGAAATGGGGAGG - Exonic
1103530296 12:121596439-121596461 CAGAACAGGGAACAAGGGGCCGG - Intergenic
1104408046 12:128534799-128534821 CAGAAATGGGAGAAATGCATAGG - Intronic
1104792096 12:131489747-131489769 AAGAGAAGGGAGAATGGGGCAGG + Intergenic
1105402097 13:20105045-20105067 CAGACAAGGGAGAAGTGCACGGG + Intergenic
1105462029 13:20601067-20601089 CAGAAAATAGACTAATGGGCCGG + Intronic
1105528219 13:21195441-21195463 AAGAAAACGGAGAATTGGCCTGG - Intergenic
1105665828 13:22554752-22554774 CAGAAAAGAGAGGCATGGGGTGG + Intergenic
1105804229 13:23940829-23940851 CTTAAGAGGGAGAAATGGGAAGG - Intergenic
1105828309 13:24142444-24142466 CTGAGGGGGGAGAAATGGGCTGG - Intronic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106644984 13:31624053-31624075 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1107045820 13:35991060-35991082 GAGAAAAAGCAGAAATGGGATGG + Intronic
1107075235 13:36316649-36316671 CAGCAAAGGGAGATAAGGGTGGG - Intronic
1107076062 13:36322068-36322090 CAGCAAAGGGAGATAAGGGTGGG - Intronic
1107258971 13:38467911-38467933 CAGAAAAGGGACAAACAAGCAGG - Intergenic
1107296477 13:38914480-38914502 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
1107303359 13:38991299-38991321 CTGGAAAGGGAGGAAGGGGCAGG - Intergenic
1107384659 13:39894784-39894806 CACAAATGGGAGAGCTGGGCTGG + Intergenic
1107772785 13:43806510-43806532 CAAAAATGGGATAAATGGCCGGG - Intergenic
1107804099 13:44138201-44138223 TAGAAAAGGCAAATATGGGCCGG - Intergenic
1108196659 13:48001885-48001907 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108463577 13:50692377-50692399 CAGAAAAGGAGGAAAGGGGTTGG - Intronic
1108912937 13:55578327-55578349 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108913759 13:55583737-55583759 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1109343281 13:61088744-61088766 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1109343410 13:61089497-61089519 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
1109498958 13:63213425-63213447 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1109709181 13:66141433-66141455 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1109709979 13:66146706-66146728 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1109717126 13:66231991-66232013 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1110568118 13:76976600-76976622 CAGAAAGAAGAGAAATGTGCTGG - Intergenic
1110650837 13:77939079-77939101 CAGTAAAGGGAGATAGGGGTGGG + Intergenic
1110765302 13:79275291-79275313 CAGAAAAGCGGGAAAAGGGTCGG - Intergenic
1111119943 13:83833706-83833728 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1111362295 13:87191026-87191048 CAGAAAAGAGGGAAAGGGGTTGG + Intergenic
1111387647 13:87548098-87548120 AAGAAAATGGAGAAACGGCCAGG + Intergenic
1111608454 13:90571838-90571860 CAGATAAGTGAGAAATAGGATGG + Intergenic
1112445250 13:99458327-99458349 GAATGAAGGGAGAAATGGGCTGG + Intergenic
1114261660 14:21041288-21041310 CAAAAAAGGCAAAAATGGCCAGG - Intronic
1114429702 14:22650269-22650291 TAGAAAAGGAAAAAAAGGGCCGG + Intergenic
1114771288 14:25430641-25430663 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1115106871 14:29771909-29771931 TTCAAAAGGGAGAAATGGGAAGG - Intronic
1115904644 14:38191948-38191970 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1117060928 14:51962698-51962720 CAGAAAAGGGAGAGATTTTCTGG + Intronic
1117730818 14:58720098-58720120 AAGAAAAGGAAGGACTGGGCCGG + Intergenic
1118037936 14:61888467-61888489 AAGAAAAGGGAGAGATGTGGGGG + Intergenic
1118503085 14:66381718-66381740 GTGAAAAGGGAAAAGTGGGCAGG - Intergenic
1118624626 14:67646620-67646642 TATGAAAGGGAGAAATGGACAGG - Intronic
1118814865 14:69303755-69303777 CAATAAAGGGAGGAAAGGGCAGG - Intronic
1118937475 14:70300745-70300767 CAGAAAAGCGGGAAAGGGGTTGG + Intergenic
1118990831 14:70795606-70795628 TAGAAAATGCAGAAAAGGGCTGG - Intronic
1119022257 14:71125451-71125473 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
1119247872 14:73128552-73128574 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1119379785 14:74221208-74221230 CAGAAAAGGAATGAAAGGGCCGG + Intergenic
1119407286 14:74406743-74406765 CAGAAAAGGATGATAGGGGCGGG + Exonic
1119584317 14:75818132-75818154 CAGAAAAGAAAGAATGGGGCCGG - Intronic
1119734978 14:76976037-76976059 CAGAGAAGGGAGGAGTGTGCAGG + Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1119825343 14:77653206-77653228 AAGAAAAGGAAGAAAAGGGCTGG + Intergenic
1120250879 14:82061004-82061026 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
1120305121 14:82760252-82760274 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1120438218 14:84504751-84504773 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
1120617990 14:86731875-86731897 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1120659432 14:87234792-87234814 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1120661291 14:87254174-87254196 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1120901667 14:89580885-89580907 GAGAATAGGGGGAAATGGCCAGG + Intronic
1121255467 14:92527345-92527367 TAAGAAAGGGAGAAATGGCCAGG - Intronic
1121389136 14:93559492-93559514 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1121477021 14:94218223-94218245 AAGAGAAAGGAGAAATGGGAAGG + Intronic
1121704157 14:95978739-95978761 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1121915495 14:97833952-97833974 GAGAAAGGGGAGAAATGGAAGGG - Intergenic
1121980063 14:98446894-98446916 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1121980835 14:98452317-98452339 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1122146794 14:99694795-99694817 AAGAAAGAGGAGAAATTGGCTGG - Intronic
1122233696 14:100320330-100320352 CGGAGGAGGGAGAGATGGGCAGG - Intergenic
1122507368 14:102240198-102240220 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1124860141 15:33431464-33431486 CTGAAAAGGAAGAGAGGGGCTGG + Intronic
1125045404 15:35238937-35238959 CAGCAAAGGGAGATAAGGGTGGG - Intronic
1125046163 15:35243712-35243734 CAGCAAAGGGAGATAAGGGTGGG - Intronic
1125046400 15:35246134-35246156 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1126154346 15:45551338-45551360 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1126912701 15:53432133-53432155 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1126952315 15:53894414-53894436 CAGGAAAGGGATAAAGGGGTTGG - Intergenic
1127541282 15:59941369-59941391 CAGAAGAGGGAGCAGTGGGGTGG - Intergenic
1127598013 15:60506554-60506576 CAGAAAAGGAAGAGATTGGCTGG + Intronic
1127619735 15:60722128-60722150 GAGTTAAGGGAGAAAAGGGCAGG - Intronic
1127816155 15:62610952-62610974 CAGAAAAGGGAAAAATTAGAAGG - Intronic
1128041050 15:64573707-64573729 TAGACAAGGGTGAAATAGGCAGG - Intronic
1128125872 15:65192472-65192494 AAGAAGAGAGAGAAATTGGCCGG + Intergenic
1128157693 15:65402159-65402181 CAGAGAAGAAAGAACTGGGCTGG - Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128504383 15:68256402-68256424 TAAAAAAGGGAAAAATGGCCGGG - Intronic
1128690767 15:69723278-69723300 CAGAACAGGCAGGAATGAGCAGG - Intergenic
1128885052 15:71279131-71279153 CAGGAAAGGGAGAAAATGGAGGG + Intronic
1129220638 15:74129828-74129850 CAGATATGGGAGAAATGCTCGGG + Exonic
1129520682 15:76184063-76184085 CAGAAAAGGGGCCAAAGGGCAGG + Intronic
1131447368 15:92511646-92511668 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1131769303 15:95717727-95717749 CAGAAACTGGAGATATGGGAGGG - Intergenic
1132001206 15:98181826-98181848 GAGAAAAGGGGCACATGGGCAGG + Intergenic
1132262843 15:100441434-100441456 CAGAAAAGCGAGAAAGGGGTTGG - Intronic
1132340246 15:101073698-101073720 CAGAAAAGTGGGAAAGGGGTCGG - Intronic
1132944584 16:2525973-2525995 CAGAAAAAGGAACACTGGGCTGG - Intronic
1133072948 16:3258668-3258690 AAAAAAAGGGTGAATTGGGCTGG + Intergenic
1133256120 16:4517437-4517459 AAGAAAAGGGAGCAGTGGCCAGG + Intronic
1133580514 16:7140205-7140227 CAGAAAATGGACAAATTGGGAGG - Intronic
1133651228 16:7815860-7815882 CAGAAAAGCGGGAAAGGGGTGGG - Intergenic
1133766887 16:8844358-8844380 CAGAAAAGCGGGAAAGGGGTTGG + Intronic
1133869943 16:9676921-9676943 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1134291788 16:12907312-12907334 AAGAGAAGGGAGAAAAGGGAAGG - Intronic
1134327971 16:13224470-13224492 CTGAAATATGAGAAATGGGCAGG - Intronic
1134658439 16:15965586-15965608 TTAAAAAGGGAGAAAGGGGCTGG - Intronic
1135693873 16:24569498-24569520 CAGAAAAAGAAGAAAAGGGGAGG + Exonic
1137302652 16:47167624-47167646 CAGCAAAGGGAGATAAGGGTGGG - Intronic
1137421251 16:48336523-48336545 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1137687439 16:50396239-50396261 CAAAAAAGGAAGCAGTGGGCAGG + Intergenic
1137923906 16:52521384-52521406 CAGAGAAGGTAGAACTGGCCAGG - Intronic
1137951406 16:52787126-52787148 ATGAAGAGGGAGAAATGGGGAGG - Intergenic
1138600921 16:58053543-58053565 CAAAAAAGCCAGAAATGGCCGGG + Intergenic
1138759276 16:59522186-59522208 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1138805587 16:60085548-60085570 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1138862377 16:60774308-60774330 CAAAAGAGGGAGAAAGCGGCCGG + Intergenic
1139039400 16:62983707-62983729 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
1139225430 16:65229906-65229928 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1139226189 16:65235001-65235023 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1139230097 16:65275359-65275381 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1140317271 16:73911288-73911310 CAGAAAAGAAAGAAAAGGCCAGG + Intergenic
1140761568 16:78113562-78113584 CAGAAAAGTGAGAACTAGCCAGG - Intronic
1140939717 16:79710039-79710061 CAAAGATGGGGGAAATGGGCTGG - Intergenic
1141191671 16:81829512-81829534 TATAAAACAGAGAAATGGGCCGG - Intronic
1141865514 16:86747306-86747328 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
1142253985 16:89005282-89005304 CAGAAAAGATAGAACTCGGCTGG - Intergenic
1142695734 17:1632095-1632117 CTGAAAAGGGGCAAATGGCCAGG + Intergenic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1144104299 17:11972064-11972086 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1144363009 17:14514103-14514125 AAGCAAAGAAAGAAATGGGCAGG - Intergenic
1144512520 17:15889396-15889418 TAGAAAATGTAGAAATGCGCAGG + Intergenic
1144625153 17:16840679-16840701 GACAAAAGGGTGAAATGGGAAGG - Intergenic
1144767231 17:17739450-17739472 CAGAGCAGGGAGAGATGGGGAGG + Intronic
1144881276 17:18432042-18432064 GACAAAAGGGTGAAATGGGAAGG + Intergenic
1145024594 17:19458433-19458455 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1145150956 17:20512344-20512366 GACAAAAGGGTGAAATGGGAAGG - Intergenic
1145296396 17:21595965-21595987 GAGAGAAGGGAGAAAAGGGGAGG + Intergenic
1146047313 17:29519913-29519935 CATAAAAGTGAAACATGGGCTGG + Intronic
1146165964 17:30588995-30589017 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1146304072 17:31716596-31716618 AAAAAAAGTGAGAAAAGGGCTGG + Intergenic
1146505375 17:33400128-33400150 GAGAAAAGAGAGAAATTGGTGGG - Intronic
1146597544 17:34183499-34183521 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1146804656 17:35855627-35855649 GAGAAGAGGAAGAAGTGGGCAGG + Intronic
1147288619 17:39423159-39423181 CAGAAATCTCAGAAATGGGCTGG - Intronic
1147579306 17:41619378-41619400 GACAAAAGGGTGAAATGGGAAGG - Intergenic
1148206432 17:45783189-45783211 CTGAAAAGGGAGAAACTGGGAGG - Intergenic
1148680155 17:49469117-49469139 CAGAGAAGAGAGGAATGGGCTGG + Intronic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1149158575 17:53664061-53664083 CACCAAAGGGAGAAATTGGAAGG - Intergenic
1149488323 17:57062670-57062692 TAGAAAATACAGAAATGGGCTGG - Intergenic
1150243690 17:63657119-63657141 CAGAAAAGGAAGAGAAGGGGTGG - Intronic
1150582140 17:66483754-66483776 CAAAAAAGGGAAATTTGGGCTGG - Intronic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151272854 17:73010264-73010286 ATGAAAAGGGAGAAAGGGTCTGG - Intronic
1151839925 17:76610491-76610513 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
1151840049 17:76611186-76611208 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152550824 17:81029051-81029073 CACCAAAGGGAAAACTGGGCTGG - Intergenic
1153052941 18:917359-917381 CAGCGAAGAGAGAAAGGGGCAGG - Intergenic
1153497545 18:5715418-5715440 CAGAAAAGGGAAGAGTTGGCAGG + Intergenic
1153647075 18:7204975-7204997 GAGAAAAGGGAGAAGCGGGGTGG - Intergenic
1153834835 18:8954637-8954659 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1153957932 18:10113939-10113961 CATACAAGGGAGACTTGGGCAGG - Intergenic
1154003351 18:10505874-10505896 AAGAAAAGGGGGAAATGTGGGGG - Intergenic
1154238871 18:12633303-12633325 TAGAAAATGCAAAAATGGGCCGG + Intronic
1155141271 18:23046853-23046875 CAGAAAAGGAAAAGAGGGGCTGG - Intergenic
1155174376 18:23289923-23289945 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1155892199 18:31284300-31284322 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1155941376 18:31804933-31804955 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1156252200 18:35361485-35361507 CAGCAAAGGGAGATAGGGGCGGG + Intergenic
1156417928 18:36917917-36917939 CAGAAACAGGAAAAATGGGAGGG - Intronic
1156487012 18:37472765-37472787 CAGAGAAGGGAGAAATTGGGAGG + Intronic
1156745598 18:40387465-40387487 CATAAAAGGTAGTTATGGGCAGG + Intergenic
1156894141 18:42225205-42225227 CAAAAAAGGGAAAAATAGGGAGG - Intergenic
1156923553 18:42552540-42552562 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1156938301 18:42737315-42737337 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157319532 18:46623696-46623718 CAGAAAAGGCAGACACTGGCAGG + Intronic
1157379786 18:47203094-47203116 CAGAAAAGAGAGAAAAGGAAAGG + Intergenic
1157503939 18:48212784-48212806 CAGACAAGGGGGGATTGGGCTGG + Intronic
1157514177 18:48299113-48299135 CAGAAAATAGTGAAATGGGAGGG + Intronic
1157896340 18:51471870-51471892 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1157906576 18:51574624-51574646 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1157907326 18:51581219-51581241 CAGAAAAGGAAGAATTGAGATGG - Intergenic
1158355618 18:56615455-56615477 CAGAAAAAGAAAAAATGGGGGGG + Intronic
1158577015 18:58646440-58646462 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1159130458 18:64275429-64275451 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1159153857 18:64556520-64556542 CAGAAAAGAGACATGTGGGCTGG - Intergenic
1159164301 18:64682791-64682813 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1160130462 18:76220844-76220866 CACAAAAGTGAGAAATGACCGGG + Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160660731 19:297359-297381 AAGAAAAGGAAAAAAAGGGCTGG + Intergenic
1160673720 19:377731-377753 CAGAAAGGGGAGGGATGGTCAGG - Intergenic
1161577063 19:5060141-5060163 GACAAAAGGGAGCCATGGGCCGG + Intronic
1161712648 19:5858153-5858175 CAGCAAAGGGAGATAGGGGGTGG - Intergenic
1161931726 19:7345096-7345118 CAAAAGTGGGAGAAAAGGGCAGG + Intergenic
1162085142 19:8244192-8244214 CAGAAAAGGCAGGAAATGGCTGG + Intronic
1162135973 19:8555558-8555580 GAGCAGAGGGAGGAATGGGCCGG - Intronic
1162230361 19:9260907-9260929 TAGAAAAGGCAGCAAGGGGCCGG - Intergenic
1162255289 19:9483846-9483868 TAGAAAAGGGGGAAATGTGGGGG + Intronic
1162261733 19:9539648-9539670 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1162263378 19:9550447-9550469 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1162266795 19:9582521-9582543 CAGCAAAGGGAGATAGGGGTCGG - Intronic
1162557476 19:11396465-11396487 CAAAAAATAGAGAAATTGGCTGG - Intronic
1163481426 19:17558861-17558883 ATGGAAAGGGAGAAATGGGCCGG + Intronic
1163596298 19:18222998-18223020 CAGAAAAAAAAGAAATGGGGAGG - Intronic
1163692161 19:18743884-18743906 CAGGAAAGGGAGAGAAGGGCAGG - Intronic
1163693647 19:18751225-18751247 AAGAAAATGGGGAAATGGGCTGG + Intronic
1163943937 19:20518933-20518955 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1164003565 19:21129450-21129472 CAGCAAAGGGAGATAGGAGCGGG + Intergenic
1164080542 19:21858384-21858406 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1164082081 19:21867265-21867287 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1164142426 19:22484792-22484814 GAGACAAGGGAGAATTAGGCAGG + Intronic
1164259261 19:23554930-23554952 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1165253708 19:34559774-34559796 CAGAAAAGGCAGGACTGGGATGG + Intergenic
1165272548 19:34723455-34723477 CAGAAAAGGCAGGACTGGGATGG - Intergenic
1165413146 19:35674743-35674765 TGGAAAAGGAAGAAATTGGCTGG + Intronic
1165835824 19:38755174-38755196 CAGCGAAGGGAGATAAGGGCGGG - Intronic
1166259377 19:41627157-41627179 CAAAAAAGGCAGAAATGAGAGGG - Intronic
1166499305 19:43329054-43329076 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1166575700 19:43835496-43835518 CAGAAAAGCCAGAACTGGGGAGG - Exonic
1166644131 19:44518723-44518745 CAGGATGGGGAGAAATGAGCAGG - Intronic
1166653287 19:44591596-44591618 CAGTAAAGGGAGATAGGGGTGGG + Intergenic
1166778722 19:45328423-45328445 AAGAGAAAGGAGGAATGGGCAGG - Intergenic
1166813181 19:45526379-45526401 GACCAAAGGGAGAAAAGGGCGGG - Exonic
1167099236 19:47393836-47393858 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1167099951 19:47398633-47398655 CAGTGAAGGGAGATAAGGGCGGG - Intergenic
1167129374 19:47573967-47573989 CAAAGAAGGGAGGAATAGGCTGG - Intergenic
1167553401 19:50176893-50176915 AAGATAAAGGAGAAATAGGCTGG - Intergenic
1167682590 19:50933438-50933460 GAGAAAATGAAGAAAGGGGCCGG - Intergenic
1167828256 19:51995028-51995050 CAGAAAAGGGTGATAAGGGGAGG + Intronic
1168052127 19:53837225-53837247 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1168072386 19:53960297-53960319 CAGAAAAGAGAGGAAGGGGCCGG + Intergenic
1168228148 19:55011315-55011337 CAGAAAAGCGGGAAAGGGGTTGG + Intergenic
1168675486 19:58275030-58275052 CAAATAAGGGAGAAAGGGGGTGG + Intronic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
925455526 2:4013538-4013560 CAAAAAGTGGAGAAATGGGGTGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926825074 2:16898225-16898247 CAGAAACAGGAGAAAAGGACAGG + Intergenic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
927035431 2:19170287-19170309 GAGAGAAGGGAGAAAAGGGCAGG + Intergenic
927240943 2:20919136-20919158 CAGAAATGGGTGAGATGGCCTGG - Intergenic
927424802 2:22970291-22970313 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
928104999 2:28464497-28464519 CAGGAAAGTGAGAGTTGGGCCGG + Intronic
928301958 2:30133155-30133177 TAGAAAAGGAAAAATTGGGCTGG + Intergenic
928369407 2:30730367-30730389 CAGAAATGGTAGAAATGGTCAGG - Intronic
928856998 2:35814240-35814262 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
929076844 2:38085307-38085329 CAGAAAAGCGGGAAAGGGGTTGG + Intronic
929182646 2:39060033-39060055 GTGAAAAGGGAGAAAAGGGAAGG + Intronic
929383230 2:41378137-41378159 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
929444375 2:41991464-41991486 GAGAAATGGGAGAATCGGGCAGG - Intergenic
929590410 2:43142165-43142187 TAGAAAAGGGTGAAAAAGGCCGG + Intergenic
929595528 2:43173311-43173333 TAAAAAAAGGACAAATGGGCTGG - Intergenic
929874380 2:45784355-45784377 CAAAAAAGGAAGAAGTGGGCTGG + Intronic
929932509 2:46269805-46269827 GAGTAGAGGGGGAAATGGGCTGG - Intergenic
930186646 2:48418371-48418393 CAGATAGGGGAGAGATGTGCAGG - Intergenic
930272947 2:49277863-49277885 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
930351176 2:50256820-50256842 CAAGAAAGAGGGAAATGGGCAGG - Intronic
930547024 2:52781216-52781238 GAGAAAATAGAGAAAGGGGCAGG - Intergenic
931093992 2:58919353-58919375 CTGAAAAGGGAGAATTGGGCAGG - Intergenic
931585608 2:63823874-63823896 CAAAATAGTGGGAAATGGGCTGG + Intronic
931608417 2:64074908-64074930 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
931626174 2:64257525-64257547 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
931694564 2:64861979-64862001 CAGAAAGGGGATAATTGTGCTGG - Intergenic
931714349 2:65017193-65017215 CCAGAAAGGGAGAATTGGGCAGG - Intronic
931948098 2:67332754-67332776 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
931952121 2:67376378-67376400 AGGAGAAGGGAGAAATGGGGGGG - Intergenic
932158896 2:69443112-69443134 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
932584509 2:73018242-73018264 CAGAAAAGGAAGAAAAGGAAAGG + Intronic
932710125 2:74056921-74056943 CACAACTTGGAGAAATGGGCTGG + Intronic
932798600 2:74719304-74719326 CAGACAAGGGAAATATTGGCTGG + Intergenic
932828092 2:74959453-74959475 CAGACAAGGGAGGGCTGGGCTGG + Intronic
932854536 2:75219188-75219210 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
932873912 2:75430972-75430994 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
933163414 2:79051675-79051697 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
933183438 2:79252769-79252791 CAAAAATGGGAGTAATGGGGGGG - Intronic
933417580 2:82005960-82005982 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
933447303 2:82398376-82398398 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
933873390 2:86593053-86593075 CAGAAAAGCGAGCAGTGAGCTGG - Intronic
934227093 2:90143703-90143725 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
935724968 2:106015741-106015763 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
936098771 2:109555966-109555988 ATGAGAAGGGAGAGATGGGCAGG - Intronic
936589289 2:113787843-113787865 TAGAAAAGTGACAAATGGTCGGG - Intergenic
936790134 2:116141775-116141797 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
936794545 2:116189401-116189423 CAGCAAAGGGAGATAGGGGTAGG + Intergenic
936870540 2:117130872-117130894 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
936963639 2:118103949-118103971 CAGAGAAGGTAGAAAGGGGAAGG - Intronic
936999059 2:118446645-118446667 AAGAAAAGGATGAAATGGGTGGG - Intergenic
937133272 2:119529386-119529408 CAGAAAAGGGGGACATGGAGTGG - Intergenic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937303977 2:120859946-120859968 CAAAAAAGGGAGTATTGGCCGGG - Intronic
937635138 2:124147076-124147098 CAAAAAGGGGAAAAATGTGCAGG + Intronic
937736470 2:125296865-125296887 TGGAAAAGGGAGAAAAGAGCGGG - Intergenic
937942436 2:127296433-127296455 TCCAAAAGGGAGAAATGGGAAGG - Intergenic
938556412 2:132428730-132428752 TAGAAAAGGGTGAATTGGGAAGG + Intronic
938858963 2:135346394-135346416 CATAAAAGCTAGAAATAGGCTGG - Intronic
938985558 2:136571982-136572004 CTGGAAAGGGAGGAAGGGGCCGG - Intergenic
939083312 2:137687519-137687541 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
939166438 2:138645950-138645972 GAGAAAAGGGAGACTGGGGCTGG + Intergenic
939500135 2:142974230-142974252 CAGTAAAGGGAAAAGTGGGCTGG + Intronic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940726681 2:157343170-157343192 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
940835413 2:158515882-158515904 CAGAAAATTTAAAAATGGGCTGG + Intronic
940884911 2:158980936-158980958 CAGAAAAGTCAGGAATGGGAGGG - Intronic
941528996 2:166641572-166641594 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
941704266 2:168641182-168641204 CAGAGAAGGGTGAAATGGGGCGG - Intronic
941936058 2:170982207-170982229 CAGAAAAGCGTGAAAGGGGTCGG + Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943315506 2:186382546-186382568 CATAAAAGTGAGAAATGGAAAGG + Intergenic
943834837 2:192506367-192506389 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
943951464 2:194135459-194135481 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
943951603 2:194136244-194136266 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
944251983 2:197587602-197587624 CAGCGAAGGGAGAAAGGGGTAGG - Intronic
944387277 2:199180534-199180556 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
944876287 2:203966456-203966478 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
945094937 2:206209942-206209964 AAGAAAAGAAAGAAAAGGGCCGG - Intronic
945152618 2:206806939-206806961 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
945153440 2:206812278-206812300 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
945173285 2:207018381-207018403 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
945361481 2:208900383-208900405 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
945362507 2:208908246-208908268 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
945375771 2:209078346-209078368 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945376652 2:209084256-209084278 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945394779 2:209304814-209304836 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
945836440 2:214840485-214840507 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
946174967 2:217916990-217917012 CACAAGAGGGAGGAAAGGGCGGG - Intronic
946503681 2:220276490-220276512 CAGCGAAGGGAGATATGGGTGGG - Intergenic
946817831 2:223597465-223597487 AAGAAAAGGCAGAAAAGGGAAGG - Exonic
946885164 2:224215786-224215808 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
946893109 2:224297847-224297869 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
946893750 2:224302240-224302262 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
946940094 2:224761232-224761254 GAGTAAAGGGAGAAAGGGACAGG + Intergenic
948074906 2:235158524-235158546 CAGAAAGGCAAGAAATGGGGTGG - Intergenic
948389934 2:237604707-237604729 TAGAAAATGGAGAAACGGCCGGG + Intergenic
948390312 2:237607072-237607094 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948391169 2:237612531-237612553 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948424900 2:237880999-237881021 AAGGAATGAGAGAAATGGGCAGG - Intronic
1168875652 20:1170546-1170568 CAGAAAAGGAAGGATTGGGAAGG + Intronic
1169020915 20:2330227-2330249 CAGCAAAGGGAGAAAACAGCAGG + Intronic
1169072581 20:2742523-2742545 CAGAAAAGGGAGTAAGGGAAAGG - Intronic
1169239582 20:3964812-3964834 TAGAATGGGGAGAAATTGGCCGG - Intronic
1169504402 20:6193128-6193150 CAGAAACTGGAGAATTGGGGAGG + Intergenic
1169755945 20:9043380-9043402 TATAAAAGGGAAAAGTGGGCTGG + Intergenic
1169768222 20:9172431-9172453 CAGGAAAGGGAGAGATGGACAGG - Intronic
1170068380 20:12340370-12340392 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1170069179 20:12345609-12345631 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1170166230 20:13362566-13362588 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1170687896 20:18585903-18585925 TAAAAAAGGGAAAATTGGGCTGG - Intronic
1170718271 20:18851201-18851223 CAGAAAATGTAAAAATTGGCTGG - Intergenic
1170775675 20:19372830-19372852 CAGAGAAGGATGAAATGTGCTGG - Intronic
1170818751 20:19738467-19738489 AAGAAGAGGGAAACATGGGCCGG + Intergenic
1171236352 20:23528407-23528429 CAGTAAAGGGAGATAGGGGTGGG + Intergenic
1171493084 20:25535853-25535875 CAGAAAAGGGAGCCAAGGGAAGG + Intronic
1171872702 20:30541738-30541760 GAGAAAAGGAAAAAATGTGCAGG + Intergenic
1171966522 20:31534787-31534809 AAAAAAAAGAAGAAATGGGCCGG + Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172234265 20:33359338-33359360 GAGAAAAGGGAGAAGTGGCTGGG - Intronic
1172430275 20:34884901-34884923 CAAAAAAGAAAGAAATAGGCTGG + Intronic
1172785364 20:37464943-37464965 CTAAGAAGGAAGAAATGGGCTGG - Intergenic
1172932851 20:38598489-38598511 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1173201302 20:40957203-40957225 GAGAGAAGGGAGAAAGGGGTAGG + Intergenic
1173370159 20:42427976-42427998 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1173453354 20:43184894-43184916 CAGTAGAGGCAGAAATGAGCAGG - Intronic
1173781504 20:45760602-45760624 CAGAAAAGTGGGAAAGGGGTTGG - Intronic
1173879513 20:46401272-46401294 CAGAAAAGGGAGGATTTGACTGG + Intronic
1174234884 20:49081280-49081302 CAAAAAATAAAGAAATGGGCCGG - Intronic
1175362210 20:58421602-58421624 CAGAAATGGGAAAAATGCACTGG - Intronic
1175466864 20:59195231-59195253 GAGAAAAGGGGGAAATGTGGTGG + Intronic
1175510841 20:59525065-59525087 CAGGAATGGTAGAAATGGGTGGG - Intergenic
1176074005 20:63240293-63240315 CAGAACAGGCAGAGAGGGGCAGG - Exonic
1176742588 21:10617515-10617537 AAGAAAAGGGAGAAAGGGTGGGG + Intergenic
1177100459 21:16893328-16893350 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1177116018 21:17088063-17088085 CAGCAAAGGGAGACAAGGGTGGG - Intergenic
1177119394 21:17122626-17122648 CAGAAAAGCGGGAAAGGGGTTGG - Intergenic
1177147459 21:17421957-17421979 TAGAAAAGGGACTCATGGGCCGG + Intergenic
1177222183 21:18209250-18209272 TAGAAAAGGGAAGAATGAGCAGG - Intronic
1177689280 21:24482898-24482920 TAGAAAAGGGAGAAATAGACCGG - Intergenic
1177861271 21:26457375-26457397 CAGAAAAGGGATAGAAGGGGAGG + Intergenic
1178001680 21:28166801-28166823 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1178063537 21:28877616-28877638 GAGAAAAGAGAGAAATAGGAAGG + Intronic
1178280372 21:31277347-31277369 TAGAAAGGGGAGGCATGGGCTGG + Intronic
1179019604 21:37626427-37626449 AAGAAAAGGGAAAAGTGGCCAGG - Intronic
1179246459 21:39638026-39638048 CATAAAAGTGAGAAATGGCCCGG - Intronic
1179262806 21:39773458-39773480 AAGAAAAGGAAGAAAGGGGAGGG - Intronic
1179387391 21:40956109-40956131 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1179412630 21:41174069-41174091 AGGAAAAAGGAAAAATGGGCAGG - Intronic
1179893002 21:44346595-44346617 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1181015722 22:20067425-20067447 CAAAAAAGGAAGATTTGGGCTGG + Intergenic
1181161421 22:20962185-20962207 AAGAAAAGGGAGGAAGGGGAGGG - Intergenic
1181596635 22:23919346-23919368 AAAAAAAGAGAGAAAGGGGCCGG + Intergenic
1181799086 22:25332570-25332592 AAGAAACGGAAGACATGGGCTGG + Intergenic
1181922142 22:26328762-26328784 GAGAAAAGGGAGAAAGGAGGAGG + Intronic
1181931746 22:26407459-26407481 TAAAAAAGGATGAAATGGGCCGG + Intergenic
1182334332 22:29573359-29573381 CATAAAAATGAGAAATGGGCCGG + Intronic
1182363763 22:29764204-29764226 CAGAGGAGGGAGAAATGAGTAGG - Intronic
1182731950 22:32503062-32503084 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1183046938 22:35227883-35227905 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1183606002 22:38866985-38867007 CCGAGAAGGGCGAAATGGGCGGG + Exonic
1183636441 22:39066197-39066219 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1183733335 22:39630234-39630256 CAGAGAAGGGAGAAAGGGTTGGG - Intronic
1183936232 22:41264028-41264050 AACCAAAGGGAGAAAAGGGCTGG - Intronic
1183945462 22:41323439-41323461 GGGAAATGGGAGAACTGGGCTGG - Intronic
1184050187 22:41998609-41998631 GAGAAAGGGGAGAAAGAGGCGGG - Intergenic
1184272643 22:43393403-43393425 CTGAAGAGGGAGAATTGGGGTGG + Intergenic
1184569484 22:45312880-45312902 CATAAAAGGCATAAAAGGGCTGG - Intronic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
1185081872 22:48713995-48714017 CAGACACGGGAGGACTGGGCTGG - Intronic
1203322905 22_KI270737v1_random:85955-85977 GAGAAAAGGAAGAAAAGGGAGGG - Intergenic
949143815 3:670327-670349 CTGAAAATAGACAAATGGGCTGG - Intergenic
949827275 3:8178177-8178199 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
949896368 3:8769671-8769693 CAAGAAAGGAAGAAACGGGCGGG - Intronic
950002811 3:9670022-9670044 TATAAAAGGAGGAAATGGGCTGG + Intronic
950157224 3:10730765-10730787 CAGCGAAGGGAGATAGGGGCGGG - Intergenic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
951298349 3:20967642-20967664 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
951315815 3:21189121-21189143 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
951558353 3:23943525-23943547 TAGAAAAGGCAAAACTGGGCTGG - Intronic
951621958 3:24611852-24611874 TAACAAAGGGAGAAATGGGGTGG + Intergenic
951779134 3:26343291-26343313 TAGAAAAGGGATGCATGGGCAGG - Intergenic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952339352 3:32432405-32432427 CAGCATAGAGAGGAATGGGCGGG - Intronic
952343047 3:32461036-32461058 CAGCAAAGGGAGATAGGGGTGGG + Intronic
952559738 3:34577447-34577469 TAGAAAAGGTGGGAATGGGCAGG + Intergenic
952663623 3:35878905-35878927 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
952688311 3:36175172-36175194 AAGAAAAGGGAAGAATGGGAAGG - Intergenic
952752043 3:36832461-36832483 CTGAAAAGGATGAAAGGGGCAGG - Exonic
952765722 3:36952473-36952495 TAGAAAAGTGGGAAATGGGCCGG - Intergenic
952853617 3:37749672-37749694 CAGAAAATGGAGAAATGCTAGGG + Intronic
952895434 3:38075591-38075613 CAGAAAAGTGGGAAAGGGGTCGG + Intronic
952944294 3:38467149-38467171 TAAAAAAGAGACAAATGGGCTGG + Intronic
953077299 3:39582351-39582373 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953177664 3:40566551-40566573 CAGCAAAGGGAGATAGGGGTGGG - Intronic
953196377 3:40738165-40738187 AATAAAAGAGAGAAATGGGATGG - Intergenic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953639015 3:44688245-44688267 CAAATAAGGGAGAAAGGGGGTGG - Intergenic
953651066 3:44804721-44804743 AGGAAAAGTGAGAAATGGGTTGG - Intronic
953732492 3:45462284-45462306 CAGAACAGGAAGAAAAGGGCTGG + Intronic
953826035 3:46251709-46251731 CAGCAAAGGGAGATAAGGGTGGG + Intronic
954109706 3:48427218-48427240 GACAACAGGAAGAAATGGGCGGG + Intronic
954759268 3:52862113-52862135 CAGAAATGGCAGAGCTGGGCAGG - Intronic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
955341716 3:58130201-58130223 CAGAACGGAGAGAGATGGGCAGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956233757 3:67043853-67043875 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
956358317 3:68418242-68418264 CAGCAAAGGGAGATAAGGGTGGG + Intronic
956548476 3:70434773-70434795 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
956709740 3:72028783-72028805 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
956919697 3:73913924-73913946 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
957154746 3:76533677-76533699 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957155364 3:76537780-76537802 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957394156 3:79618603-79618625 CAGCAAAGGGAGATAAGGGTGGG - Intronic
957394583 3:79621318-79621340 CAGCAAAGGGAGATAGGGGTGGG - Intronic
957416345 3:79910162-79910184 CAAAGAAGGAAGAAATGGTCAGG - Intergenic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
958181857 3:90071419-90071441 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
958421689 3:93938318-93938340 CAGCAAAGGGAGATAGGGGTGGG - Intronic
958756529 3:98256105-98256127 CAGTAAAGGGAGATAGGGGTGGG + Intergenic
958768356 3:98397076-98397098 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
958936719 3:100263105-100263127 CAGCGAAGGGAGATAAGGGCGGG + Intronic
959287877 3:104440031-104440053 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
959485935 3:106927265-106927287 CAGAAAAGTGAGAAAGGGGTTGG + Intergenic
959543586 3:107569471-107569493 CAGTAAAGGGAGATAGGGGTGGG + Intronic
959904257 3:111693080-111693102 AAGCAAAGGGAGAATTGGGCTGG + Intronic
960215059 3:115023718-115023740 AAGAAAAGGGAGAAAAGTGGGGG - Intronic
960243499 3:115373439-115373461 AAGAAAAGGAAGAAATCGGGAGG - Intergenic
960863066 3:122171398-122171420 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
960878666 3:122322560-122322582 CAGTAAAGTAAGAACTGGGCTGG + Intergenic
961343750 3:126247647-126247669 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
961424688 3:126835710-126835732 CTGAAAAGAGAGAGATGGGGAGG - Intronic
961716154 3:128858878-128858900 CAAAAAAGGAGGAAATGGGAGGG - Intergenic
961731064 3:128965275-128965297 CAGCAAAGGGAGATAGGGGTGGG - Intronic
961880691 3:130059440-130059462 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
961880889 3:130060431-130060453 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
961881521 3:130064851-130064873 CAGGAAAGGGAGATAGGGGTGGG - Intergenic
961893881 3:130151702-130151724 CAGAAAAGCAGGAAATGGGTTGG + Intergenic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
961925323 3:130473431-130473453 CAGAAAAGGGGGAAAAAAGCAGG - Intronic
962058872 3:131904262-131904284 CAGAAATAGGAGGAACGGGCTGG - Intronic
962552867 3:136513047-136513069 CAAAAAAGGGAGACTTGGGCCGG + Intronic
962910086 3:139840134-139840156 CAGAAAAGGGGAAAATTGGGAGG + Intergenic
963058261 3:141205185-141205207 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
963059264 3:141211608-141211630 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
963319470 3:143797817-143797839 CAGTGAAGGGAGATATGGGTGGG - Intronic
963425044 3:145114107-145114129 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
963521302 3:146362372-146362394 CAGAGAAGGGAGATACGGGTGGG - Intergenic
963521451 3:146363205-146363227 CAGAAAAGTGAGAAAGGGTTCGG - Intergenic
964067647 3:152598151-152598173 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
964068360 3:152603030-152603052 CAGTGAAGGGAGATATGGGTGGG - Intergenic
964124911 3:153226249-153226271 CAGCGAAGGGAGATATGGGTGGG + Intergenic
964125635 3:153231269-153231291 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
964125818 3:153232210-153232232 CAGCGAAGGGAGACATGGGTGGG + Intergenic
964436504 3:156659001-156659023 AGGAAAGGGGAGAAGTGGGCAGG - Intergenic
964947183 3:162240390-162240412 TAGAAAAGAGAGATTTGGGCCGG + Intergenic
965104771 3:164342278-164342300 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
965105399 3:164346703-164346725 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
965317397 3:167209087-167209109 AAGAGAAGGGAGGAATGGGAAGG + Intergenic
965334786 3:167422721-167422743 CAGCAAAGGGAGATATGGGTGGG - Intergenic
965625050 3:170677079-170677101 CAGAAAAGCGGGAAAGGGGTTGG + Intronic
965640384 3:170823455-170823477 CAGAGAAGGGAGATAGGGGTGGG + Intronic
966033059 3:175374709-175374731 CAGAAAATGGAAAAATCAGCTGG + Intronic
966066675 3:175828881-175828903 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
966233008 3:177670383-177670405 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
966233084 3:177670782-177670804 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
966278895 3:178207690-178207712 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
966685271 3:182686609-182686631 AATAAAAGGGGGAAATGGGCTGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966877212 3:184329334-184329356 AGAAAAAGGAAGAAATGGGCCGG + Intronic
967117724 3:186356885-186356907 AAGAGAAGGGGGAAAAGGGCGGG - Intronic
967118032 3:186359965-186359987 AAGAGAAGGGGGAAAAGGGCGGG - Intronic
967409041 3:189148888-189148910 CAGGAACGGGAGAAATGGGATGG - Intronic
967496705 3:190150081-190150103 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
967522235 3:190446009-190446031 CAGAAAAGGGAGACTTGGATTGG - Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
967926976 3:194658055-194658077 CAGAGACGGGAGAAAAGGACAGG + Intronic
968020864 3:195387750-195387772 TAAAAAGGGGAAAAATGGGCTGG - Intronic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968522299 4:1039535-1039557 CAGACAAGGGCGCAAGGGGCAGG - Intergenic
968647634 4:1748442-1748464 CAGAAAGTGGAGTGATGGGCTGG - Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968993219 4:3928536-3928558 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
969003978 4:4004777-4004799 CAGAAAAGCGAGAAAGGGGTTGG + Intergenic
969339030 4:6528893-6528915 CAGCAAAGGGAGATAGGGGTGGG - Intronic
969508601 4:7604112-7604134 CAAACAAGGCAGAGATGGGCAGG + Intronic
969653536 4:8482500-8482522 CAGCAAAGGGAGATAGGGGTGGG + Intronic
969654281 4:8487397-8487419 CAGAAAAGCGGGAAAGGGGTCGG + Intronic
969748890 4:9095407-9095429 CAGAAAAGAGGGAAAGGGGTTGG - Intergenic
969809953 4:9640048-9640070 CAGAAAAGCGAGAAAGGGGTTGG - Intergenic
969855920 4:9999599-9999621 CAGAAAGGGAAGGAGTGGGCTGG + Intronic
969899733 4:10337822-10337844 CAGCAAAGGGAGCAATGGCAAGG - Intergenic
970481387 4:16479422-16479444 AAGAAAAGGGAGAAAGGGATAGG - Intergenic
970723589 4:19016639-19016661 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971508327 4:27391158-27391180 AAGAAAAGACAGAAATGTGCAGG - Intergenic
971980795 4:33747553-33747575 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
972138142 4:35918881-35918903 CAGAGAAGTGAGAAAGGAGCTGG + Intergenic
972213682 4:36870131-36870153 CAGAAAAGGGAGAGAAAGGAGGG + Intergenic
972362841 4:38344938-38344960 CAGAACAGGGTGAAAGGGGAAGG - Intergenic
972712149 4:41608225-41608247 AAGAAAAGGGAGGAATGGCGGGG + Intronic
975167883 4:71198667-71198689 CATATAAGAGAGAAATAGGCTGG + Intronic
975250534 4:72173484-72173506 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
975302857 4:72811687-72811709 GAGAAAAGGGAGAAAAAGACTGG + Intergenic
975370581 4:73581700-73581722 GAGAAAGGGGAGGAATGGGTAGG - Intronic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
975891378 4:79032712-79032734 CAAAAAAGAGAAAAATTGGCTGG + Intergenic
976102912 4:81584401-81584423 CAGAAAAGAGAGAAAGGGAAAGG + Intronic
976966318 4:91045890-91045912 CAGCAAAGGGAGATAGGGGTGGG + Intronic
976983922 4:91268650-91268672 CAGCAAAGGGAGATAGGGGTGGG + Intronic
977197958 4:94084714-94084736 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
977660796 4:99582994-99583016 CAGATAAGGTAGAATAGGGCAGG + Intronic
978031187 4:103941600-103941622 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
978244094 4:106551518-106551540 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
978438447 4:108710182-108710204 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
978873400 4:113607689-113607711 CAGCAAAGGGAGATAGGGGTGGG - Intronic
979146452 4:117253245-117253267 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
979641105 4:123013052-123013074 CAGCAAAGGGAGATAGGGGTGGG + Intronic
979850649 4:125567107-125567129 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
979871370 4:125826791-125826813 CAGATAAGGTAGAAATGTACAGG - Intergenic
979996919 4:127442427-127442449 AAGAATAGGGAGAACCGGGCAGG + Intergenic
980035160 4:127874709-127874731 CAGAAATGGGAATTATGGGCTGG - Intergenic
980112099 4:128645383-128645405 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
980388756 4:132119358-132119380 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
980903762 4:138929031-138929053 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
980928013 4:139158075-139158097 CAGAGAAGGGAGATAGGGGTGGG + Intronic
981040088 4:140214722-140214744 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
981539362 4:145832886-145832908 CAGCAAAGGGAGATAAGGGTGGG - Intronic
982084270 4:151817932-151817954 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
982358866 4:154497251-154497273 CAGAAAAGGGGAAATTAGGCAGG - Intergenic
982396885 4:154923423-154923445 CAGAAAAGTGGGAAAGGGGCCGG + Intergenic
982458845 4:155642628-155642650 CAGAAAAGGCAGAAAAGAGGAGG + Intergenic
982612695 4:157596685-157596707 CAGCGAAGGGAGAAAGGGGTGGG + Intergenic
982774198 4:159425490-159425512 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
982791358 4:159595294-159595316 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
983024344 4:162714624-162714646 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
983056023 4:163100040-163100062 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983056581 4:163103990-163104012 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983359535 4:166710314-166710336 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
983360057 4:166716452-166716474 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
983360902 4:166721931-166721953 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
983387608 4:167085138-167085160 CAGACAAGGGAGGAATGAACTGG - Intronic
983638281 4:169920063-169920085 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984109125 4:175588374-175588396 CAGACAAGGTAGAAAAGAGCTGG - Intergenic
984270716 4:177545557-177545579 AAGAACAGGTAGAGATGGGCAGG + Intergenic
984393329 4:179166577-179166599 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
984393922 4:179170219-179170241 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
984436955 4:179720810-179720832 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984700283 4:182814618-182814640 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984773129 4:183455613-183455635 CATAAAAGGAAAAAATGTGCTGG + Intergenic
984803297 4:183733779-183733801 CAGAAAAGGAAGAAAGGGGAAGG - Intergenic
985482299 5:121501-121523 GAGGAAAGTGAGAAAAGGGCAGG + Intergenic
985663915 5:1172054-1172076 CAGCAAAGTGGGAAATGGGAAGG + Intergenic
985726806 5:1520562-1520584 TAGAAATGGGGAAAATGGGCCGG + Intronic
986227142 5:5826448-5826470 CAGAAAAGGGAGCAAATGGGAGG + Intergenic
986389362 5:7269210-7269232 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
987183695 5:15392526-15392548 TAGAAAAAGGAGAAATCGGCCGG + Intergenic
987281870 5:16421163-16421185 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
987497646 5:18668944-18668966 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
987755459 5:22094939-22094961 CAGCAAAGGGAGATAGGGGTGGG - Intronic
988017057 5:25572553-25572575 CAGAAAAGGTAAAAATGGTCTGG + Intergenic
988057891 5:26124060-26124082 GAGAAAAGGGAGAGATGAGGAGG + Intergenic
989028640 5:37093751-37093773 CAGAAAAGGGAGAGATGTAGGGG + Intergenic
989546127 5:42675988-42676010 TAAAAAAGGAAGAAATTGGCTGG + Intronic
989698788 5:44236729-44236751 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
990413163 5:55561236-55561258 GAGAAAAGGGAGAAATACCCTGG + Intergenic
990532336 5:56686924-56686946 CTGCAAAGGCAGAAATGTGCTGG - Intergenic
991423149 5:66462232-66462254 CAGAAAAAGGAGAATAGAGCTGG - Intergenic
992733049 5:79691159-79691181 CAGAAGAGGGAGTGTTGGGCTGG + Intronic
992787705 5:80185604-80185626 CAGCAAAGGGAGATAAGGGTGGG + Intronic
992960497 5:81953540-81953562 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
992961343 5:81959112-81959134 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
993495666 5:88605898-88605920 CAGAAAAGGGAGTACTGGGCAGG - Intergenic
993676936 5:90826935-90826957 CAGGAAAAGGGGAAATGGACTGG - Intronic
994012239 5:94918984-94919006 AAAAAAAGGGAGACATGGGTTGG - Intronic
994325519 5:98441213-98441235 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
994545116 5:101156140-101156162 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
994775373 5:104031995-104032017 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
994907249 5:105857386-105857408 GAGATAAGGGGGAAATGGGGAGG - Intergenic
995850230 5:116537240-116537262 CAGAAAAGTTAGAACTGGGAAGG + Intronic
995858637 5:116619098-116619120 CTGAAAAGGGAGATAGGGGTGGG + Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996509593 5:124304091-124304113 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
996764342 5:127020687-127020709 CAAAAAATGGAGAAATTAGCTGG + Intronic
997132174 5:131287946-131287968 CAAAAATGGGAGAAGTGGCCGGG + Intronic
997400472 5:133598124-133598146 GGGAAAGGAGAGAAATGGGCAGG - Intronic
997611200 5:135216953-135216975 CACAAAAGGGACAAATTAGCTGG - Intronic
997746235 5:136302458-136302480 CAGAAAAGTGGGAAAGGGGTCGG - Intronic
998265957 5:140668075-140668097 CTGAAAATGGAGAAATGAGATGG + Intronic
998468925 5:142367955-142367977 AGGTACAGGGAGAAATGGGCTGG - Intergenic
998879196 5:146629750-146629772 AAGAAAAGGAAGAAAAGGGGAGG - Intronic
998996016 5:147869937-147869959 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
999341773 5:150779099-150779121 ATGAAAAGGGAGAAATGGGGAGG - Intronic
999477099 5:151910563-151910585 CAGAAAAGTCAAAAATGGCCAGG - Intronic
999826308 5:155276778-155276800 GACAAAAGGGAAAAATGGGAGGG - Intergenic
1000242473 5:159421369-159421391 CAGAGAAGGGAGAGAGGAGCAGG - Intergenic
1000496610 5:161991953-161991975 CTGAATAGGGAGAAATAGTCAGG - Intergenic
1000885619 5:166744350-166744372 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1000935089 5:167297732-167297754 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1001017354 5:168153599-168153621 ATGAGAAGAGAGAAATGGGCAGG + Intronic
1001082915 5:168680174-168680196 CAGACATGGGGAAAATGGGCTGG - Intronic
1001123865 5:169001911-169001933 CAGAGAAGGGAGACATTGGTGGG + Intronic
1001275380 5:170346999-170347021 CAGAAAAGGCAGAGTTGGGAAGG + Intergenic
1001459856 5:171902114-171902136 CAGAATAGAGAGATATGGACTGG - Intronic
1001586600 5:172837001-172837023 GAGAAAAGGGAGAGATTGGAGGG + Intronic
1001637596 5:173223149-173223171 CCGAAAGGGGGAAAATGGGCAGG - Intergenic
1002026047 5:176396947-176396969 GAAAAAAGGGAAAAAAGGGCAGG - Intronic
1002079671 5:176729860-176729882 AAGAAAAGGGCAAAAGGGGCTGG + Intergenic
1003100612 6:3173733-3173755 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1003220305 6:4155241-4155263 CAGAAAACAGAGGAAGGGGCTGG + Intergenic
1003587731 6:7408389-7408411 GAGCAAAGGCAGAAATGGGAAGG - Intronic
1003857667 6:10292703-10292725 CATAAAATGAAGAAAAGGGCCGG + Intergenic
1003990336 6:11480544-11480566 GAGAACAGAGGGAAATGGGCAGG + Intergenic
1004105869 6:12667456-12667478 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1004132159 6:12930752-12930774 CAGAAAGGTGACAAATGAGCCGG + Intronic
1004508164 6:16263546-16263568 CAGAAAAGCGGGAAAGGGGTTGG + Intronic
1004768097 6:18754245-18754267 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1004768751 6:18758620-18758642 CAGAAAAGCGGGAAAGGGGTTGG + Intergenic
1004768927 6:18759581-18759603 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1005068250 6:21840003-21840025 TGGAGAAGGGAGAAATGGGGAGG - Intergenic
1005068540 6:21842814-21842836 CAGAAAAGTCAGAAATGGCATGG - Intergenic
1005672581 6:28122326-28122348 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1005739179 6:28774844-28774866 CAGAAAAGGCAGGACTGGGATGG + Intergenic
1005786848 6:29252469-29252491 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006372172 6:33651952-33651974 GAGAAAAGGCAGAAAGGGACAGG - Intronic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1007012772 6:38433609-38433631 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1007066765 6:38998155-38998177 GAGAAGAGGGAGATTTGGGCAGG + Intronic
1007301076 6:40868436-40868458 CAGCAAAGGGAGAGATGGATGGG + Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007883020 6:45188067-45188089 CAGCAAAGTGACTAATGGGCAGG - Intronic
1007908084 6:45484219-45484241 AAGAAACTGTAGAAATGGGCTGG + Intronic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1008215003 6:48777916-48777938 GAGAAGAGGGAAAAATGGGGAGG + Intergenic
1008418124 6:51266941-51266963 GAGAAATGAGAGCAATGGGCAGG + Intergenic
1008751266 6:54736802-54736824 CAGAAGAGGGAAAGCTGGGCTGG + Intergenic
1009464087 6:63950469-63950491 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1009749661 6:67867731-67867753 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1010145896 6:72669289-72669311 CACAAAAGGGAAAAATCGGAAGG + Intronic
1010362556 6:75011810-75011832 AAGAAGAGGTAGAGATGGGCAGG - Intergenic
1010381668 6:75232511-75232533 CAAAAAATCAAGAAATGGGCTGG + Intergenic
1010826481 6:80482903-80482925 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1010970499 6:82257998-82258020 CTCAAAAGGAAAAAATGGGCTGG + Intergenic
1011497464 6:87950583-87950605 CAGTGAAGGGAGAAATGGATGGG - Intergenic
1012247280 6:96939670-96939692 CAGTGAAGGGGGAAATGTGCTGG + Intronic
1012255480 6:97026865-97026887 TAGAAAAGGGATAACAGGGCTGG + Intronic
1012661985 6:101911098-101911120 TAAACAAGGGAGAAATGAGCTGG + Intronic
1012963620 6:105648692-105648714 CAGAAAAGTGAGAAATCATCTGG - Intergenic
1013578852 6:111512191-111512213 TAGAAAAGGCAAAACTGGGCTGG + Intergenic
1013780178 6:113720127-113720149 CTCACAAGGGAGAAATGGGGAGG - Intergenic
1013843230 6:114422540-114422562 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1013844057 6:114427948-114427970 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1013892191 6:115037496-115037518 CAGAGAAGGGAGATAAGGGTGGG - Intergenic
1014300472 6:119675567-119675589 CAGGAAAGGGAGGCACGGGCAGG - Intergenic
1014614837 6:123586833-123586855 CAGAAAAGCGGGAAAGGGGTCGG + Intronic
1015091260 6:129362181-129362203 CAGGAAAGGGAGAGATGGACGGG - Intronic
1015270120 6:131329014-131329036 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1015801725 6:137066812-137066834 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016113672 6:140257597-140257619 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016204371 6:141453980-141454002 CAGAAAATTGAGAAAGGGGTCGG - Intergenic
1016650696 6:146456139-146456161 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016750966 6:147630627-147630649 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1016877870 6:148881607-148881629 AAGAAAAGGTGGAAGTGGGCTGG - Intronic
1017263561 6:152416000-152416022 CTTAAAGGGGAAAAATGGGCTGG + Intronic
1017286596 6:152683271-152683293 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1017966698 6:159272989-159273011 CAGCAATGGTGGAAATGGGCTGG + Intergenic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018349333 6:162940406-162940428 GAGAGATAGGAGAAATGGGCAGG - Intronic
1018357130 6:163029476-163029498 GAGGAAAGGGAGAAGTGTGCTGG - Intronic
1018460930 6:163997512-163997534 CAGACAAGGGACCAAAGGGCAGG - Intergenic
1018521002 6:164652241-164652263 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1018521645 6:164656707-164656729 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
1018521855 6:164657755-164657777 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1018694190 6:166377928-166377950 GAGAAAAGGGAGACATATGCAGG + Intronic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020014577 7:4823600-4823622 CTGAAAAGGGAGCACTGAGCCGG - Intronic
1020315716 7:6904078-6904100 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1020315877 7:6904947-6904969 CAGAAAAGTGGGAAAGGGGTGGG - Intergenic
1020324108 7:6961233-6961255 CAGAAAAGAGGGAAAGGGGTTGG + Intergenic
1020376528 7:7493658-7493680 AAGAAAAAGGGGAAATGGGAAGG - Intronic
1020540550 7:9457801-9457823 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1020541437 7:9463868-9463890 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1020639147 7:10734084-10734106 TGGAAGAGAGAGAAATGGGCAGG - Intergenic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1020739091 7:11990524-11990546 CAGAAGAGGGAGAAAAGGAGAGG - Intergenic
1021155978 7:17210344-17210366 CAGAAAAGGTAGAAATACTCTGG - Intergenic
1021173322 7:17420639-17420661 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1021637142 7:22704415-22704437 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1021805490 7:24350505-24350527 CAGATAAGAGAGAAATGAGAAGG - Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1021848302 7:24783856-24783878 CAGAGAAGAGAGGAATGGGTTGG + Intergenic
1021915277 7:25425631-25425653 CAGAGAAGGGGGCTATGGGCTGG - Intergenic
1021975485 7:26007797-26007819 CAGAGGAGGGAGAGATGGGAGGG + Intergenic
1021977427 7:26024303-26024325 CAGCGAAGGGAGATATGGGTGGG + Intergenic
1021981794 7:26062521-26062543 AAGAAGAGGGAGAAATTGGTAGG + Intergenic
1022165759 7:27760175-27760197 CAGATAAGGGAGAAATGATTTGG - Intronic
1022359515 7:29644671-29644693 CAGAAAAGGCAGGACTGGGATGG + Intergenic
1022372711 7:29786046-29786068 CAGAAAAGCGGGAAAGGGGTTGG - Intergenic
1022573031 7:31472078-31472100 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023156917 7:37260564-37260586 CAGTGGAGGGAGAACTGGGCAGG - Intronic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023572320 7:41584860-41584882 CACAAAATCTAGAAATGGGCTGG - Intergenic
1023710372 7:42986232-42986254 CAGAAGGGGCAGAGATGGGCAGG + Intergenic
1023757848 7:43436467-43436489 CAGCGAAGGGAGATATGGGTGGG + Intronic
1024234799 7:47389878-47389900 CAGAAACGGGCCAGATGGGCGGG - Intronic
1024329765 7:48144227-48144249 CAGAAAAGGGGGAGATGTGGGGG + Intergenic
1024330023 7:48146375-48146397 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1024738093 7:52327356-52327378 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1025227483 7:57177892-57177914 CAGACAAAGGAGATATGGGGAGG + Intergenic
1026201493 7:68218394-68218416 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1027057092 7:75057275-75057297 CAAAAAATGGAGAAATTAGCTGG - Intronic
1027776845 7:82475682-82475704 TAGAAAAGGGACAGATGGGCTGG - Intergenic
1028739258 7:94253403-94253425 CTGAAAAGGGAGAAAGGGTGTGG - Intergenic
1029306834 7:99625756-99625778 CAGAACAGTCAGAAATGGCCAGG - Intronic
1029372999 7:100160977-100160999 CAGAAGAGAGAGAACTGGGCTGG + Intronic
1029657230 7:101935311-101935333 CAGCGAAGGGAGAAAGGGGTGGG - Intronic
1029658610 7:101944187-101944209 CAGAAAGGGGCGCAGTGGGCTGG + Intronic
1030193166 7:106829949-106829971 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030811853 7:113982235-113982257 ACTAAAAGGTAGAAATGGGCTGG + Intronic
1030932566 7:115542925-115542947 GAGAAAATGGACAAAAGGGCAGG - Intergenic
1031084210 7:117286422-117286444 GAGAATAGGGAGAGAAGGGCGGG - Intronic
1031193145 7:118580830-118580852 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1031249945 7:119367092-119367114 TAGGAATGGGAGGAATGGGCAGG + Intergenic
1031422632 7:121568570-121568592 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
1031730345 7:125292626-125292648 TAGAAAAAGGAAAAAAGGGCTGG - Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1032369672 7:131334287-131334309 GAGAAAAGGGAGAAAAGGAAGGG - Intronic
1032783253 7:135181264-135181286 GAGACAAGGGAGAATTAGGCAGG - Intergenic
1033284536 7:140028936-140028958 CACAAAAGGGATAAAAGGGATGG + Intronic
1033334150 7:140438070-140438092 CAAAAAAGGGAAAAAAGGCCGGG + Intergenic
1033549239 7:142431511-142431533 GAGAAGTGGGAGAAATGAGCAGG + Intergenic
1033865474 7:145686241-145686263 TGGAAAAGGGAGAATTTGGCAGG + Intergenic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1033943771 7:146688436-146688458 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1034018041 7:147608812-147608834 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1034351749 7:150420334-150420356 AAGGAAAGGGAGAAATGGACGGG - Intergenic
1034762030 7:153681571-153681593 AGGAAAAGTGAGAAATGGGAAGG - Intergenic
1034822396 7:154228515-154228537 CAGAAGACAGACAAATGGGCAGG + Intronic
1035294784 7:157860938-157860960 CAGAACAGGCACAGATGGGCTGG + Intronic
1035844516 8:2848426-2848448 AAAAATAGGGATAAATGGGCTGG - Intergenic
1035944470 8:3945738-3945760 TAGAAAACCAAGAAATGGGCTGG + Intronic
1036449484 8:8853307-8853329 CCCAAAAGGTAGAAAGGGGCAGG - Intronic
1036639325 8:10572416-10572438 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1036706456 8:11050516-11050538 CAGAAAAGGGAGAAAAGAGAGGG + Intronic
1036965078 8:13288733-13288755 CAATAAAGGGGGAAAGGGGCAGG - Intronic
1036990293 8:13584818-13584840 AAGAAAAGGGAGGATTGGGTAGG - Intergenic
1037464094 8:19142090-19142112 CAGAAAAGAGAAAATTGGGATGG + Intergenic
1037746205 8:21646909-21646931 AACAAAAGGGGGAAATGAGCTGG + Intergenic
1037960404 8:23093199-23093221 AAAAAAAGGGAGAATTGAGCAGG - Intronic
1038539997 8:28384421-28384443 CAGAGAAGGGAGTTGTGGGCAGG - Intronic
1038597729 8:28904525-28904547 AAGATTTGGGAGAAATGGGCTGG - Intronic
1039014892 8:33136151-33136173 CAGAAAGGGGAGAAATAGAATGG - Intergenic
1039381066 8:37085979-37086001 TAGAAAAGGCAGACAGGGGCAGG - Intergenic
1039465780 8:37784221-37784243 CAGCCAAGGGAGAGATGGGCTGG - Intronic
1039499261 8:38003800-38003822 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1039577104 8:38632425-38632447 AAGAAAAGGGGGAAATGAGTTGG + Intergenic
1039671613 8:39606785-39606807 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1039891182 8:41686489-41686511 CAGAAAATGGAAGAATGGGAGGG + Intronic
1040016009 8:42700614-42700636 CAGAAAAGAAATAATTGGGCCGG - Intronic
1040109312 8:43559625-43559647 CAGAAAAGGCAGGACTGGGACGG + Intergenic
1040394827 8:46987229-46987251 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1040504857 8:48038089-48038111 AAGAAAAGGGAGGATTGGACGGG - Intronic
1040608656 8:48960495-48960517 CAGAAAATGTAGCCATGGGCAGG - Intergenic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1041249180 8:55918259-55918281 CAGGAGAGGGAGGAATGGGGTGG - Intronic
1041593777 8:59622243-59622265 CAGAAAAGAGTGAGATGGGCTGG - Intergenic
1041727519 8:61031851-61031873 AATAAAAGGGAAAAATGGGGCGG + Intergenic
1042552200 8:70004092-70004114 GAGAAAAGGGAGAAAGTGGTAGG + Intergenic
1042651939 8:71052652-71052674 CAGAAAGGAGAGAAATGCCCAGG - Intergenic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1043194155 8:77269135-77269157 AAGAAAAGATAGAAATGGGAAGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043718066 8:83509683-83509705 CAGAAAAGCGGGAAAGGGGTTGG + Intergenic
1043721504 8:83550544-83550566 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1043777666 8:84290403-84290425 CAGCAAAGGGAGATAAGGGTGGG + Intronic
1044012939 8:87017120-87017142 CAGAAAAGGTAAAATTGGTCTGG + Intronic
1044019081 8:87082321-87082343 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1044459192 8:92425444-92425466 TAGAAAAGGAAGGAATGGGTGGG + Intergenic
1044531228 8:93309969-93309991 CAGAGAAGGGAGGAAAGTGCAGG - Intergenic
1045559469 8:103246988-103247010 TAGTAAATGGAGAAATTGGCAGG - Intergenic
1045685233 8:104704644-104704666 CAGAAAAGGTAAAATTGGGAAGG - Intronic
1045778736 8:105838601-105838623 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1046386695 8:113515027-113515049 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1046439733 8:114241931-114241953 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1046440493 8:114246962-114246984 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1046646828 8:116794371-116794393 CAGGAAAGGGAGAAATGGCTTGG + Intronic
1046962726 8:120127082-120127104 CAGGTTAGGGAGAAATGGGGAGG - Intronic
1047309148 8:123677349-123677371 CAGAAGCTGAAGAAATGGGCTGG + Intergenic
1047643283 8:126843742-126843764 CAGACCAGGGAGCAAGGGGCTGG - Intergenic
1047856205 8:128915562-128915584 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1047868680 8:129058070-129058092 CATTAAAGAGAGAAATGGTCAGG - Intergenic
1048179973 8:132185471-132185493 CAGCAAATGCAGACATGGGCTGG - Intronic
1048194439 8:132320730-132320752 CAGAAAAGGGAAGGAAGGGCAGG + Intronic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048584955 8:135767292-135767314 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1048747383 8:137630042-137630064 GAGAAAAGTGAGAAACGGGCAGG + Intergenic
1049176087 8:141193532-141193554 CCGAAAAGGGAGAAATTGGAAGG + Intronic
1049183474 8:141235635-141235657 CGGAAGAGGGAGAGAGGGGCAGG + Intronic
1049447860 8:142639690-142639712 GAGAAAAGGGAGGACAGGGCGGG + Intergenic
1049626388 8:143624169-143624191 CAAAATAGGGAGAACTCGGCCGG - Intergenic
1050140209 9:2509995-2510017 CAGCAAAGGGAGAATAGGGGCGG - Intergenic
1050518733 9:6474407-6474429 GATTAAAAGGAGAAATGGGCTGG + Intronic
1050629296 9:7541879-7541901 TAGCTAAGGGACAAATGGGCAGG - Intergenic
1050656529 9:7834507-7834529 AAGAAAAGGGAGAATTGGGAGGG - Intronic
1050908707 9:11038961-11038983 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1051409848 9:16778100-16778122 CAGAAAATAGAGAAAAGGGGAGG - Intronic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1052162918 9:25288842-25288864 CAGAAAAGCGGGAAAGGGGTAGG - Intergenic
1052411457 9:28127124-28127146 CAGAGAAGGAAGAAATTGCCAGG - Intronic
1052720811 9:32169073-32169095 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1052821945 9:33144532-33144554 CAGAAAAAGAGAAAATGGGCTGG - Intronic
1053019995 9:34688146-34688168 TTGAAAAGGGAGAAATGGTGAGG - Intergenic
1053321531 9:37103127-37103149 AAGAAAAGGAAGGAAAGGGCTGG + Intergenic
1055626366 9:78180982-78181004 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1055627259 9:78186697-78186719 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1055881446 9:81009362-81009384 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056323487 9:85458652-85458674 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1057136207 9:92689838-92689860 TAGAAAAGGAAAAAATGGGCTGG - Intergenic
1057137300 9:92701748-92701770 CAAAAAAGGGGGAGAGGGGCTGG - Intergenic
1057234515 9:93347915-93347937 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1057235326 9:93353221-93353243 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1057423075 9:94927662-94927684 CAGGGGAGGGAGAGATGGGCAGG - Intronic
1057641822 9:96831102-96831124 GAGAAAAGGGAGAAAGGGAGGGG + Intronic
1057855098 9:98595560-98595582 AAGAATAGGGAGGAATGGGCTGG - Intronic
1057919406 9:99084575-99084597 CTTAAAAAGGAGAAATGGTCCGG + Intergenic
1058425313 9:104870766-104870788 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1058561728 9:106236134-106236156 GAGAGAAGGGATAGATGGGCTGG + Intergenic
1058860404 9:109112779-109112801 GAGAAAAGGGATAATTCGGCCGG + Intronic
1059455396 9:114397401-114397423 CAGAAGGAGAAGAAATGGGCTGG - Intergenic
1059863801 9:118491049-118491071 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
1060318767 9:122535847-122535869 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1060601577 9:124881690-124881712 AGGAAAAGAGAGAAAGGGGCTGG + Intronic
1060727982 9:126018463-126018485 CTTTAAAGGGATAAATGGGCCGG - Intergenic
1061147898 9:128810467-128810489 CAGAACAGGGAAAAATGAACAGG + Intergenic
1062258735 9:135646255-135646277 TTTAAAAGGGAGAAGTGGGCTGG - Intergenic
1062486797 9:136781289-136781311 AAGAAAAGGGGGAAATGTGGGGG - Intergenic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185734339 X:2485729-2485751 GAGAAAAGGGAGAGAAGGGAGGG + Intronic
1185889177 X:3809245-3809267 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1185961047 X:4545974-4545996 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1186113048 X:6276743-6276765 CAGAAAAGCGGGAAAGGGGTCGG + Intergenic
1186116307 X:6308240-6308262 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1186688743 X:11952537-11952559 TGGAAAAGGGAGGCATGGGCTGG - Intergenic
1186783893 X:12940951-12940973 CAGAAAAGCGGGAAAGGGGTCGG - Intergenic
1186877089 X:13827438-13827460 CTAAGAAGGGGGAAATGGGCTGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187086692 X:16049227-16049249 CAGAAAAGCGGGAAAGGGGTTGG + Intergenic
1187104610 X:16228153-16228175 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1188042141 X:25381007-25381029 CTGAAAAGGGAGCAATGTTCAGG + Intergenic
1188463543 X:30453626-30453648 CAGAAAAGCGGGAAAGGGGTTGG + Intergenic
1188464788 X:30467574-30467596 AAAAAAAAGGAGAAATGAGCAGG - Intergenic
1188552369 X:31378051-31378073 CAGCAAAGGGAGACAGGGGTGGG - Intronic
1188984062 X:36753808-36753830 CACATAAGGGAGAACTTGGCAGG - Intergenic
1189348342 X:40259162-40259184 CAACAAGGGGAGAGATGGGCAGG - Intergenic
1189706572 X:43764715-43764737 CACAAAAGGGAGGGATGGGGGGG - Intergenic
1189709835 X:43797961-43797983 CAGAAAAGGTAGGCATGGGCTGG - Intronic
1190275083 X:48894051-48894073 CAGAACAGGGTGGAAGGGGCTGG + Intronic
1190419764 X:50217565-50217587 CAGTGAAGGGAAAAATGGCCGGG - Intronic
1190474662 X:50814293-50814315 AAGAAAACGGAGCAATGGGGAGG + Intronic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1190707791 X:53044974-53044996 CAAATAAGGGAGAAAAGGGGTGG + Intergenic
1190857573 X:54312021-54312043 TAGAAAAGGAAGGTATGGGCTGG + Intronic
1191117396 X:56866057-56866079 CACAAACTGCAGAAATGGGCAGG + Intergenic
1191205511 X:57829410-57829432 AAGGAAAGGAAGAAATGGGGAGG + Intergenic
1191697468 X:64004644-64004666 CAGAAAGGGGAGAAAGGGAAGGG + Intergenic
1191763018 X:64664480-64664502 CAGAAATAGGACCAATGGGCTGG - Intergenic
1192073222 X:67962669-67962691 CAGAAAGGGGAGAAAAGAGTAGG + Intergenic
1192134347 X:68583020-68583042 CAGAAAGGTGAGGAATGGGATGG - Intergenic
1192730872 X:73801560-73801582 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1192914394 X:75637387-75637409 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1193851106 X:86538023-86538045 CAGCAAAGGGAGATAGGGGTAGG - Intronic
1193994042 X:88343514-88343536 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1194180436 X:90704967-90704989 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1194350949 X:92824757-92824779 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1194366935 X:93024089-93024111 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1194483021 X:94450544-94450566 CAGAAAGGGAAGAAATAGCCAGG + Intergenic
1194822289 X:98524347-98524369 CAGCAAAGGGAGATAAGGGTGGG + Intergenic
1194874139 X:99164886-99164908 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1195065668 X:101236128-101236150 TAGGAAAGGGAGAAGTGGGTGGG - Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195326288 X:103761254-103761276 CAGATAAGGGAGATAGGGGTGGG + Intergenic
1195327154 X:103767032-103767054 CAGAGAAGGGAGACAGGGGTGGG + Intergenic
1195747822 X:108136359-108136381 AAGGAAAGGGAGAAATAGGCAGG + Intronic
1195841140 X:109178671-109178693 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1195841977 X:109184037-109184059 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1196226633 X:113176232-113176254 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196295243 X:113989622-113989644 CCAAAAAGGGAGAAATGGCATGG - Intergenic
1196774182 X:119323143-119323165 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196992305 X:121343997-121344019 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196993015 X:121348369-121348391 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1198581295 X:138067625-138067647 CAGGAAAGGAAGAAAAGGTCAGG + Intergenic
1198598286 X:138259943-138259965 CAGAAAAGCGGGAAAGGGGTTGG - Intergenic
1199073192 X:143502299-143502321 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1199284703 X:146042865-146042887 CGGAGATGGGAGAAATGGGAGGG + Intergenic
1199356893 X:146873261-146873283 CATAAAAGAGAGAACTGGGTTGG + Intergenic
1199377514 X:147131773-147131795 CAGCGAAGGGAGATATGGGTGGG + Intergenic
1199377951 X:147134472-147134494 CAGTAAAGGGAGATAGGGGTGGG + Intergenic
1199576311 X:149316832-149316854 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1200314498 X:155117527-155117549 AAGAAAAGGGAGAAATGGCTTGG + Intronic
1200546824 Y:4527974-4527996 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1200659275 Y:5941437-5941459 CAGCAAAGGGAGATAAGGGTGGG - Intergenic
1200659962 Y:5945913-5945935 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1200675157 Y:6140345-6140367 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1201233484 Y:11888585-11888607 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201937956 Y:19427617-19427639 CAGTAAAGGGAGATAGGGGTGGG - Intergenic
1202062864 Y:20905607-20905629 CAGCAAAGGGAGATAGGGGCGGG - Intergenic